Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093195 Similarity: 0.954 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA093195
Gene: RPS8
MFE: -62.671
ENS: 0.858
Length: 180.
Predicted Ligands:
cobalamin - 11/20
lysine - 8/20
TPP - 1/20
 RS: URS0000C6B068_1209931
MFE: -51.625
Ligand: TPP
Species: Colletotrichum salicis TPP riboswitch (THI element)
 RS: URS0000C133B0_1565991
MFE: -53.555
Ligand: lysine
Species: Bacillus sp. X1(2014) Lysine riboswitch
 RS: URS0000DB669D_1122930
MFE: -61.974
Ligand: lysine
Species: Papillibacter cinnamivorans DSM 12816 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093195 URS0000C6B068_1209931 URS0000C133B0_1565991 URS0000DB669D_1122930
Length 180. 181. 182. 179.
Similarity - 0.954 0.951 0.950
Ensemble Norm 0.858 - - -
MFE -62.671 -51.625 -53.555 -61.974
Ligands - TPP lysine lysine
Gene RPS8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 3.001 15.002
Length SE - 1. 4. 1.
Lev Distance - 55. 58. 57.
UBS 13. 13. 13. 16.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 3. 3. 3. 3.
H 4. 5. 5. 5.
BL 6. 3. 5. 6.
BR 4. 4. 3. 6.
UN 0.111 0.066 0.088 0.061

Sequences

Field Description
UTR seq + 25 aggcucguggcccuaggcgcggcagcugacacguaagucucgucgcccgacguuguuucggcgcucagaaacaacguaaaguaaaggggcggggcagcguuuuacaaaccgaaccgugaaucuuugcgguuucucuuuccagccagcgccgagcgATGGGCATCTCTCGGGACAACTGGC
UTR dot + 25 ..((.((((.(….).))))))…(((.((((..((((((((.(((.((((((((((……..))))))))))…)….)))))))))).)))).)))……(((((((((….)))))))))………(((((..(((((.(((….))).)))))…..)))))
RS 1 seq AAGAACGCAUCCGGGUGUUCAACUCAUCUACCGUGCCCGACACCAAAGGCCCUCUUGAUAUCUUUCAUCGAUUGAGAGGCGUACUCGGGUGGAUUUAGGCACGGGAAAUGACUUGAUCUGAGAAAUACCGGUGAACUUGAUCUGGAUAAUACCAGCGAAAGGACAUGCUUCUUUGGCAACC
RS 1 dot ..((((((……))))))…((((…(((((((.((((((..(((((((((((((………..))))))))).)).))..))))…)).)))))))…))))…((((.(((………….)))))))(((……)))((.((((((…..)))))).))….
RS 2 seq AGUGAGGAUAGAGGCGCAAAGACCAUUAGUACCCAUUCGGAGGAUAAUGAGGUCCGAAGAUGAAUGGCGAAAGGGGAAUUUGCCGAAGUUUCAAUGAACCUCAUUGUUCUUGAAGCUGGUUCUGCUGUUGAAUAAGCACAGAACUGUCAUAUAGGUAAACUAUAUGGAGGGCUAUCUCACGC
RS 2 dot .(((.((.(((.(((…..).)).)))…)))))…((((((((((((((.((..((….(((((((…….)))))))…..))..)).))))))))))))))……(((((((.((((…..)))))))))))..(((((((…..)))))))((((….))))….
RS 3 seq AUGCAGGAUAGAGGCGCAACCUUCAAUAUUAGCGCGGGGAGGGCUCCGGAUAGGCCCCUUGAACCGAUUGCGAAAGGGACGGUUGCCGAAGAGCGGGCGAUACCGGGGUCGUCUUCUCUGGGUGCCGUGUGAACAGCCCGGCAACUGUCAUCAGGGUUUGAUGGAGAGCUAUCUGCUUU
RS 3 dot ..((..((((((((…..))))…)))).))..(((((.((((((((.((.(((((((((((((.((.(….).))))))).)….))).))))..)))))))))).)))))……(((((.((…..)).))))).((((((……..))))))(((((…..)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table