Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093227 Similarity: 0.978 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA093227
Gene: RPSA
MFE: -29.154
ENS: 0.783
Length: 110.
Predicted Ligands:
TPP - 17/20
cobalamin - 1/20
glycine - 1/20
 RS: URS000232EA76_1617423
MFE: -27.709
Ligand: cobalamin
Species: Acidobacteria bacterium OLB17 Cobalamin riboswitch
 RS: URS0000C8693D_1750719
MFE: -27.266
Ligand: TPP
Species: Kurthia sp. 11kri321 TPP riboswitch (THI element)
 RS: URS0000C19692_1262863
MFE: -27.303
Ligand: TPP
Species: Coprococcus sp. CAG:782 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093227 URS000232EA76_1617423 URS0000C8693D_1750719 URS0000C19692_1262863
Length 110. 111. 109. 110.
Similarity - 0.978 0.977 0.977
Ensemble Norm 0.783 - - -
MFE -29.154 -27.709 -27.266 -27.303
Ligands - cobalamin TPP TPP
Gene RPSA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 2.003
Length SE - 1. 1. 0.
Lev Distance - 28. 28. 30.
UBS 5. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 2.
ILR 1. 1. 2. 1.
H 2. 1. 2. 2.
BL 1. 1. 2. 0.
BR 2. 2. 2. 1.
UN 0.227 0.234 0.211 0.173

Sequences

Field Description
UTR seq + 25 cgccugucuuuuccgugcuaccugcagagggguccauacggcguuguucuggauucccgucguaacuuaaagggaaauuuucacaATGTCCGGAGCCCTTGATGTCCTGC
UTR dot + 25 ……………(((…..)))(((((.(((….((((((((……(((((………….)))))……)))))))).))).)))))……….
RS 1 seq AGCUUUAUUGACAACAACGUUGGCUGUUCAAGGCGAAGGAAGUUCGGUGUGAAUCCGACGCUGCCCACGCAACCGUGAAAGUCGGGAACUUUGCUUUGAUCGGGCCUUGGC
RS 1 dot …………………(((((.(((((((((….(((((………(((((……((((….))))…))))))))))))))))))).))).))…..
RS 2 seq AUAGUGUGCUAGGAGUGCUGGUGUUGCCAGCUGAGAUGGAGCCGUAAGCUCUGGAUUCUUUCAACCUGAUCUAGUUCAUACUAGCGUAGGGAAGCCGUUUCGACCGAAA
RS 2 dot …………….((((((…))))))((((((((..((.((.((((((((((……….)))))))……..))).)).))…))))))))…….
RS 3 seq AAAAAACAAAUGGGGAGCUUGCGGCUGCAGGCUGAGAGUAGGCAAUGUGAAGCCUUGACCCACAACCUGAUUUGGGUAAUGCCAACGUAGGGAUAUAUCUGCUUUCUUUU
RS 3 dot ……………(((((((….)))))))((((((((…(((((…((((((((((……….)))))……….))))).)))))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table