Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093228 Similarity: 0.969 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA093228
Gene: RPSA_0
MFE: -36.501
ENS: 0.930
Length: 134.
Predicted Ligands:
cobalamin - 7/20
FMN - 5/20
molybdenum - 3/20
 RS: URS0000C84DB1_1262892
MFE: -30.284
Ligand: zmp-ztp
Species: Eubacterium sp. CAG:76 ZMP/ZTP riboswitch
 RS: URS0000C156F2_1227360
MFE: -24.458
Ligand: FMN
Species: Viridibacillus arenosi FSL R5-213 FMN riboswitch (RFN element)
 RS: URS00023161AE_1161902
MFE: -25.425
Ligand: cobalamin
Species: Eubacterium nodatum ATCC 33099 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093228 URS0000C84DB1_1262892 URS0000C156F2_1227360 URS00023161AE_1161902
Length 134. 133. 134. 134.
Similarity - 0.969 0.964 0.962
Ensemble Norm 0.930 - - -
MFE -36.501 -30.284 -24.458 -25.425
Ligands - zmp-ztp FMN cobalamin
Gene RPSA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 11.001 14.011
Length SE - 1. 0. 0.
Lev Distance - 39. 45. 47.
UBS 5. 7. 7. 6.
BS 0. 0. 0. 3.
ILL 3. 4. 2. 2.
ILR 1. 2. 2. 2.
H 1. 1. 1. 2.
BL 1. 1. 3. 2.
BR 2. 2. 3. 2.
UN 0.067 0.068 0.045 0.172

Sequences

Field Description
UTR seq + 25 guacauaaggacgucauuuccugccgccugucuuuuccgugcuaccugcagagggguccauacggcguuguucuggauucccgucguaacuuaaagggaaauuuucacaATGTCCGGAGCCCTTGATGTCCTGC
UTR dot + 25 …….(((((((((……………………………..((((.(((….((((((((……(((((………….)))))……)))))))).))).)))))))))))))..
RS 1 seq UAUGAGCUGUACGACUGGCGGAAAGCAUAUUAUACAGAGCUUUUAAUUGGUUAAAGUUAUGGAAUAUGUGUGGGAUUACCCACAGGGAGUACAGUAUAUAUAUGAUUAUCAGCCGACCGCCUGGGCAGCCCCU
RS 1 dot …..(((((.((…(((((…………………….((((((..(((((((..(((((((((((….))))))……….))))).)))))))…))))))))))))).)))))….
RS 2 seq AUAAUCCUUCGGGGUCGGGUGAAAUUCCCAAUCGACGGUGAUAAAGUAAAACUUUUAAGCCCGUGAGCCUUUUUUAGGCAGGAUAUGGUGAGAAUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGAAGGAUGUA
RS 2 dot …(((((((……………(((((.(((((.(((………………..(((((.((((…..))))….)))))………………..))).))).)).))))))))))))…
RS 3 seq CUUUAACUAAUUGAAUAAUAUCUGCUUAACAGGGGGAAGUAAGUGAAAAUCUUACACGGUCACGCCACUGUGAACCUCAAUUUGGAAUAGAAUUUAGGUAUAGUCAGGAUACCGGUUUUGCAGAUGCUGUUUGA
RS 3 dot ……….(((((((.(((((((..(((……..(((((…….))))).((((….(((((((..((((.(((((……))))).)))))))))..))..)))))))..))))))).)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table