Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093240-0 Similarity: 0.988 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA093240-0
Gene: RPSA_1
MFE: -8.808
ENS: 0.888
Length: 59.
Predicted Ligands:
unknown - 9/20
fluoride - 6/20
glutamine - 2/20
 RS: URS0000BFD21A_65393
MFE: -12.651
Ligand: glutamine
Species: Cyanothece sp. PCC 7424 Glutamine riboswitch
 RS: URS0000D6CC7B_441772
MFE: -12.734
Ligand: fluoride
Species: Clostridium botulinum F str. Langeland Fluoride riboswitch
 RS: URS000080E2D6_32630
MFE: -17.782
Ligand: preQ_1
Species: synthetic construct preQ1-II (pre queuosine) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093240-0 URS0000BFD21A_65393 URS0000D6CC7B_441772 URS000080E2D6_32630
Length 59. 59. 60. 59.
Similarity - 0.988 0.988 0.988
Ensemble Norm 0.888 - - -
MFE -8.808 -12.651 -12.734 -17.782
Ligands - glutamine fluoride preQ_1
Gene RPSA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.003 1.017 3.003
Length SE - 0. 1. 0.
Lev Distance - 16. 15. 16.
UBS 3. 3. 3. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 1. 0. 0.
BR 1. 1. 1. 0.
UN 0.271 0.322 0. 0.322

Sequences

Field Description
UTR seq + 25 gauucccgucguaacuuaaagggaaauuuucacaATGTCCGGAGCCCTTGATGTCCTGC
UTR dot + 25 ..(((((………….)))))………(((((.((….)).)))))…..
RS 1 seq AUCGUUCAUCUCUAUUCAAGCAGAGACGGAAGUAGGGAAAGUUCCCGAAGGAACGCGCC
RS 1 dot ….(((.(((((……..))))).)))……….(((((….)))))…..
RS 2 seq AGAAUUUUGGGCGAUGGAGUUCGUCAUUAAAUGCGUAGAGUUAAUGACUCCUACAAAUAG
RS 2 dot ………(((((……)))))………((((((((…))))).)))……
RS 3 seq GCUUGGUGCUUAGCUUCUUUCACCAAGCAUAUUACACGCGGAUAACCGCCAAAGGAGAA
RS 3 dot ((((((((…………))))))))………((((….))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table