Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093324 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA093324
Gene: RRH
MFE: -8.482
ENS: 0.977
Length: 59.
Predicted Ligands:
unknown - 13/20
glutamine - 5/20
fluoride - 2/20
RS: URS0000C0AAAC_12908
MFE: -12.817
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
RS: URS0000D67501_349102
MFE: -25.466
Ligand: unknown
Species: Rhodobacter sphaeroides ATCC 17025 sul1 RNA
RS: URS0000E6048C_1254432
MFE: -29.945
Ligand: unknown
Species: Sorangium cellulosum So0157-2 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093324 URS0000C0AAAC_12908 URS0000D67501_349102 URS0000E6048C_1254432
Length 59. 59. 58. 59.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.977 - - -
MFE -8.482 -12.817 -25.466 -29.945
Ligands - glutamine unknown unknown
Gene RRH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 3.004 1.
Length SE - 0. 1. 0.
Lev Distance - 18. 16. 18.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 2. 2. 2. 1.
UN 0.169 0.169 0.103 0.186

Sequences

Field Description
UTR seq + 25 auuaugaaggguguuucgguaucuucccuccaaaATGCTAAGAAATAATTTAGGCAACA
UTR dot + 25 ….((.((((…………..)))).))…((((.(((…..))).))))…
RS 1 seq AUCGUUCAUCUCAUUUGAUAUGAGACGGAAGUAAGUUUUCUUAACUGAAGGAACGCUGU
RS 1 dot ….(((.((((((…..)))))).)))….(((.(((((……))))).)))..
RS 2 seq CAGGAGUCCGGGUGCAAAUCCCGGAUGGCGAGCCCGGCCGCUGACCUGCCGGGGUAAC
RS 2 dot ..(..(((((((…….)))))))..).(.((((((.(…..).)))))).)…
RS 3 seq GGGUGUCGCGGCGGCGGAGCGCCGCGACAGGUCUUCGUGGGACGGUCGGGCCGCCUUCC
RS 3 dot …((((((((((……))))))))))…….(.(((.((((…))))))).).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table