Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093391 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA093391
Gene: RS1
MFE: -6.284
ENS: 0.964
Length: 60.
Predicted Ligands:
fluoride - 10/20
unknown - 4/20
glutamine - 3/20
 RS: URS0000E60499_1523413
MFE: -28.579
Ligand: unknown
Species: Novosphingobium sp. AAP1 nhaA-I RNA
 RS: URS0000E605B4_1282363
MFE: -17.692
Ligand: unknown
Species: Asticcacaulis sp. YBE204 sul1 RNA
 RS: URS0000E5FE78_1449350
MFE: -27.742
Ligand: unknown
Species: Roseivivax halodurans JCM 10272 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093391 URS0000E60499_1523413 URS0000E605B4_1282363 URS0000E5FE78_1449350
Length 60. 60. 58. 60.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.964 - - -
MFE -6.284 -28.579 -17.692 -27.742
Ligands - unknown unknown unknown
Gene RS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 2.008 6.001
Length SE - 0. 4. 0.
Lev Distance - 15. 12. 16.
UBS 4. 5. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 1. 0. 1. 2.
H 1. 1. 1. 1.
BL 2. 2. 1. 0.
BR 1. 3. 1. 1.
UN 0.150 0.117 0.241 0.117

Sequences

Field Description
UTR seq + 25 aguaagguagagcuuuggccgaggacgaggggaagATGTCACGCAAGATAGAAGGCTTTT
UTR dot + 25 ……..((((((((…….(.((.((……..)).)))…….)))))))).
RS 1 seq GGGUGCUCGCUGGCCAGAACGUGGUGCGGGCAGGCUUUUGCGCUGGUCGGGCCGCCAGCG
RS 1 dot …….(((((((……..(((.(((.(((((….)).))).))).))))))))))
RS 2 seq AAUGGACCUGGUCUGAGCUGCCGGGUGGCUAUUCCGGGCGCCGAUCCCUCGGACAACG
RS 2 dot ……….(((((((……((((.((…..)).))))…..)))))))….
RS 3 seq UCUGGACCUGGGGUGCGACUCCCCGGGUGGCUCUCCCGGCCGCCGAUCCGCCGGGUCAAC
RS 3 dot ….(((((((((..((…..(((((…….)))))….))..)).)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table