Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093411 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA093411
Gene: RSBN1L
MFE: -17.161
ENS: 0.915
Length: 69.
Predicted Ligands:
cobalamin - 10/20
fluoride - 7/20
homocysteine - 2/20
 RS: URS0000BE4489_592316
MFE: -15.605
Ligand: fluoride
Species: Pantoea sp. At-9b Fluoride riboswitch
 RS: URS0000C17B3F_291594
MFE: -33.637
Ligand: cobalamin
Species: Micromonospora rifamycinica Cobalamin riboswitch
 RS: URS0000AB1C60_267747
MFE: -24.405
Ligand: cobalamin
Species: Propionibacterium acnes KPA171202 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093411 URS0000BE4489_592316 URS0000C17B3F_291594 URS0000AB1C60_267747
Length 69. 69. 69. 68.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.915 - - -
MFE -17.161 -15.605 -33.637 -24.405
Ligands - fluoride cobalamin cobalamin
Gene RSBN1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 6.035 4.017
Length SE - 0. 0. 1.
Lev Distance - 23. 22. 22.
UBS 6. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 0. 1. 2.
H 2. 2. 3. 2.
BL 3. 2. 1. 3.
BR 2. 2. 2. 2.
UN 0.246 0.159 0.058 0.118

Sequences

Field Description
UTR seq + 25 ccgcgccggcuagcggaggagaguaaauacaacaggagcgcaaaATGGCGGAACCGCCGAGCCCCGTGC
UTR dot + 25 ((((……..))))……………((.((.((.(…..((((….))))).)))).))..
RS 1 seq CGCUAACAAGGUGAUGGCGUUCCACCUUACCCAACCGCCCCAUUAAGGGCUGAUGACGCCUGAUAUGAC
RS 1 dot ((((…..))))..(((((………..((.(.((((……)))).).)))))))………
RS 2 seq GCCGGUGAGAAUCCGGCGCGGUCGCGCCACUGUGAGCGGUUCCGUCGUCGACGGAUCCGCGAGCCAGGA
RS 2 dot (((((…….)))))(((….)))..((((..((((.((((((…)))))).))))..)).))..
RS 3 seq GAGAAGCUGGUGGGAGUCCGGCACUGUCGCGCAACCGUGACCACCAUUUGUGUGGGAGUCGGGGUACC
RS 3 dot ((.(.(((((…….)))))..).))…..(((.((((..((((….))))..)))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table