Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093429 Similarity: 0.953 Similarity: 0.951 Similarity: 0.948
UTR: 5HSAA093429
Gene: RSL24D1
MFE: -51.111
ENS: 0.998
Length: 168.
Predicted Ligands:
Mg2+ - 10/20
lysine - 5/20
TPP - 3/20
 RS: URS0000C381A6_931276
MFE: -29.898
Ligand: glycine
Species: Clostridium saccharoperbutylacetonicum ATCC 27021 Glycine riboswitch
 RS: URS0000CEA0D9_1891238
MFE: -72.142
Ligand: TPP
Species: Burkholderiales bacterium TPP
 RS: URS0000C13284_1635262
MFE: -42.220
Ligand: Mg2+
Species: Desulfotomaculum sp. 46_296 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093429 URS0000C381A6_931276 URS0000CEA0D9_1891238 URS0000C13284_1635262
Length 168. 168. 167. 168.
Similarity - 0.953 0.951 0.948
Ensemble Norm 0.998 - - -
MFE -51.111 -29.898 -72.142 -42.220
Ligands - glycine TPP Mg2+
Gene RSL24D1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 6.003 26.004
Length SE - 0. 1. 0.
Lev Distance - 62. 62. 60.
UBS 7. 8. 8. 5.
BS 4. 3. 2. 8.
ILL 1. 2. 1. 1.
ILR 1. 2. 1. 1.
H 4. 3. 4. 2.
BL 2. 2. 3. 3.
BR 3. 3. 3. 2.
UN 0.214 0.214 0.156 0.274

Sequences

Field Description
UTR seq + 25 cuggucuaacagacccgcgagaacgaaggacgcuugccuuuuuccggucggggaagggggaagaagguaacuuccggugacgggguugcaucacuuccucucaagcuuggcguuuguuuggugggguuacacgcggguucaacATGCGTATCGAAAAGTGTTATTTCT
UTR dot + 25 (((……))).(((((..(((((((.(..((((((((((((((….)))))))))(((((…(((((.((((….)))))))))….)))))…)))))….).))))))).)))))…..((((((……).)))))……………….
RS 1 seq AUGACGAAUUUGGGAGAGACUGCAAAUAAAGCAUUUUAAAGAAAAAAUUGCUUUAGACACAUGAAAAUAGGCUAGCAAGAGGACUUGUUAUUUAUUUGAUAGUGCCAUAUAGCAGCGCCGAAGGUGAAGCCGCAACAAACUCUCAGGCAAAAGGACCGAAUUCUGACG
RS 1 dot …..(((((((((((((..(((…(((((((((((……))))).))))))(.(((….(((((((.(((((((….))))))))))))))….))).)…..((..((((…))))..)).)))…..)))))………..))))))))…..
RS 2 seq UCGUAACGCUAGGGGUCCCGCACAAAUCCGCGACGUUGUCGCGGUCUGGCGAGCAAGCUCCGAAACCUCCCGCAGGAGUUUUCGGAGCUUCCUUUCCGGACGGGUGAGAGAAACCCUUGGAACCUGAUCAAGUUAACUCUUGCGCAGGGAAGCGUAUGCCGGCUUCC
RS 2 dot ……..((((((((((((…….(((((((…)))))))(((((.(((.(((((((((((.((((….)))).))))))))))).))).)))))))))……..))))))))…(((..((((……))))..)))((((((……..))))))
RS 3 seq AAAGGUCAACGCGGGAGGCUUCUACAUAGAACAUACGCCACUGCCCGGAAAUGUCGAGAGACACCAAUGGGAUAACAGGUUUUGUCGGAUUAAGGCUUUACCUAGUGUGGCUGGAGCAGUUGGCUCCUAGCUGUGUAUGUGCCAAAACUCGAACGAGCGGGGAAGAUU
RS 3 dot …..((..((((((.(((…(((((((…….((((((((((((…((((….))))(((.((((.(((..(((((((……))))))))))))))…))))))).))))).)))……)))))))…)))….)))……)))..))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table