Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093430 Similarity: 0.944 Similarity: 0.943 Similarity: 0.940
UTR: 5HSAA093430
Gene: RSL24D1_0
MFE: -67.616
ENS: 0.957
Length: 209.
Predicted Ligands:
cobalamin - 15/20
glucosamine - 3/20
FMN - 2/20
 RS: URS0002327B90_428993
MFE: -79.746
Ligand: cobalamin
Species: Pseudoxanthomonas sp. P15 Cobalamin riboswitch
 RS: URS0000D87E0D_1920422
MFE: -77.087
Ligand: FMN
Species: Paenibacillus sp. FSL H8-0548 FMN riboswitch (RFN element)
 RS: URS0000C7EAD8_1743142
MFE: -76.887
Ligand: FMN
Species: Bacillus sp. FJAT-26390 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093430 URS0002327B90_428993 URS0000D87E0D_1920422 URS0000C7EAD8_1743142
Length 209. 207. 210. 209.
Similarity - 0.944 0.943 0.940
Ensemble Norm 0.957 - - -
MFE -67.616 -79.746 -77.087 -76.887
Ligands - cobalamin FMN FMN
Gene RSL24D1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 8. 19.
Length SE - 4. 1. 0.
Lev Distance - 68. 70. 68.
UBS 15. 15. 14. 14.
BS 0. 1. 0. 0.
ILL 2. 2. 3. 2.
ILR 4. 4. 4. 2.
H 4. 4. 5. 5.
BL 7. 7. 5. 5.
BR 3. 4. 2. 6.
UN 0.148 0.101 0.162 0.163

Sequences

Field Description
UTR seq + 25 auuugaccacacggccgccggaggcacagucguguucgcaucuggucuaacagacccgcgagaacgaaggacgcuugccuuuuuccggucggggaagggggaagaagguaacuuccggugacgggguugcaucacuuccucucaagcuuggcguuuguuuggugggguuacacgcggguucaacATGCGTATCGAAAAGTGTTATTTCT
UTR dot + 25 ……((.(.((((((..(((((((.((((((.(((((.((((……))))…))))).)))……))))))))))…)))))))))..((((((((…(((((.((((….)))))))))….))))))))..(((((.((………)).)))))..((((((……).)))))……………….
RS 1 seq CACUAUCUUGUGGCUGUCGGUUCUUCCGGUUGCCGCCGGAAGAUGAAAAGGGAAGCCGGUCAGACACCGGCACUGCCCCGCAGCGGUAGGUGGAAACGAACCCGUCAUUUGGCACUGGGGCACAUGCCCUGGGAAGCGACGGGCUAGGAAGAAGCGAGAGCUUCCGCGUCCACGAGUCCGAAGACCUGCCGACAGCCGCGCGUUGCA
RS 1 dot ………(((((((((((((((((((.((((((((((……….((.(.((((((…..))))))..).)))))..))))))).)))))..)))((((((.(((..(.(((((((….))))))))))).))))))…(((.(((((….)))))….))).((.(((….))).)))))))))))))……..
RS 2 seq AGCUUCCUUCGGGGUCAGGUGAAAUUCCUAACCGGCGGUGAUCGGGACGGCACAGAUAGAUCGGACAACCGAAAUUCUGUGCCUCUCGUCAGUCCGUGACCCGGUUUAAUGAGCUUUCUUCUCGAUUAAUUUCGAGAGAAAGUGAAUUGAAACGGUGGACCUGGUGUAAAUCCGGGACCGACAGUAAAGUCUGGAUGGGAGAAGGGGAUG
RS 2 dot …………(((.(((…….))).))).(((((((.(((((.((((((((….((((….))))…))))))))))))))))..))))…(((..(((((..((((((.((((((……))))))))))))..)))))..)))(((.(((((…….))))).))).(((……)))……………..
RS 3 seq GCUUUCCUUCGGGGUCAGGUGAAAUUCCUAACCGGCGGUGAUCGGCAGGUGCAGGGGGAUCGGAUAACCGAACUUCUGUGCUUGUCGUCAGUCCGUGACCCGGUCUAAGAUGCUUUUACUCGGAGUUAUCCGAAUAAAAUGCGGAUUGGAACGGUGGACCUGGUGUAAAUCCGGGACCGACAGUACAGUCUGGAUGGGAGAAGGGGAUG
RS 3 dot …………(((.(((…….))).))).(((((((.(((((((((((((((..((((….)))).))))))))))))))))))..))))…(((.(((((..((((((((.(((((….))))).))))).)))..))))).)))(((.(((((…….))))).))).(((……)))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table