Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093483 Similarity: 0.968 Similarity: 0.967 Similarity: 0.964
UTR: 5HSAA093483
Gene: RSRC1
MFE: -48.390
ENS: 0.999
Length: 136.
Predicted Ligands:
FMN - 8/20
molybdenum - 6/20
cobalamin - 5/20
 RS: URS0002313AF8_66430
MFE: -54.460
Ligand: cobalamin
Species: Streptomyces roseus Cobalamin riboswitch
 RS: URS000231DF1D_1173025
MFE: -49.621
Ligand: cobalamin
Species: Geitlerinema sp. PCC 7407 Cobalamin riboswitch
 RS: URS0000C48AE9_1262792
MFE: -38.963
Ligand: FMN
Species: Clostridium sp. CAG:299 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093483 URS0002313AF8_66430 URS000231DF1D_1173025 URS0000C48AE9_1262792
Length 136. 137. 137. 136.
Similarity - 0.968 0.967 0.964
Ensemble Norm 0.999 - - -
MFE -48.390 -54.460 -49.621 -38.963
Ligands - cobalamin cobalamin FMN
Gene RSRC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.009 7.002 7.014
Length SE - 1. 1. 0.
Lev Distance - 41. 41. 46.
UBS 9. 9. 10. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 0. 0. 0. 1.
H 5. 5. 4. 5.
BL 2. 1. 3. 2.
BR 3. 4. 5. 4.
UN 0.066 0.161 0.109 0.184

Sequences

Field Description
UTR seq + 25 gcugagcuuaaacugaagcaaguucgguggacgccggcggcgcccugaucuaaagaaacgacucagggacugcggcgcuugcacgucaacgggaggugugagcccaaagaaATGGGACGTCGGTCATCAGATACTG
UTR dot + 25 (((((((((……….)))))))))…((((.((((..((((((((………)).)))))).))))))))(((((((.((…..)).)))))))((((……))))..(((……..)))….
RS 1 seq UCGUCUGGCAGACUGGGGCGAACCACCCCAGGCGGUGCAGGACAGGAAACCGGUGCGAAUCCGGUGCGGUCCCGCCACUGUGACCGGACCCCGCGCGGGUCCGGAAGUCAGACACUGACGCAUCGCCUCUUCACGUC
RS 1 dot ((……..))((((((…….))))))(((((((.((((..(..(((((…….))))).).)))).)).)))))..((((((((…..))))))))..(((((…)))))………………
RS 2 seq AAUCCGUUAAGAUAACGAGGCAAACGGAAUCACAGCAGCGUAGGGAAACUCCGGUGAGACUCCGGGGCUGUGCGGCAGCUGUAAGGAAUGGCUCUGCCGUUCCAAGCCAGAAUGCCUGCCUGCUGUCGGCCAUUCAA
RS 2 dot ..((((((…………..))))))…(((((.(((((.((…((((((…….)))))))).)))).).)))))..((((((((…))))))))……(((((((.((…..)).))).))))..
RS 3 seq AAUCUGUUUCAGGGCGAGGCGAAAUUCCUCACUGGCGGUGAUAAGCGUAUGCUGCGAGUCCGCGAGCUCUGCGCGUCAGGGCAGAAUGGGUGGGAACCCCAUACCAACGGUAUAGUCCGGAUGAAAGAAACAAAAA
RS 3 dot ..((((…))))..((((…….)))).(((.(..((((..(((((.((((((….))).)))..))))))))).).)))..((((((((…))))).))).(((……)))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table