Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093485 Similarity: 0.955 Similarity: 0.955 Similarity: 0.952
UTR: 5HSAA093485
Gene: RSRC1_0
MFE: -63.298
ENS: 0.975
Length: 187.
Predicted Ligands:
lysine - 10/20
cobalamin - 6/20
FMN - 4/20
 RS: URS0000D8D6B4_1665556
MFE: -51.022
Ligand: lysine
Species: Bacillus sp. LL01 Lysine riboswitch
 RS: URS0000AB33BE_1643452
MFE: -51.022
Ligand: lysine
Species: Bacillus sp. CHD6a Lysine riboswitch
 RS: URS000232C2AE_1262995
MFE: -39.157
Ligand: cobalamin
Species: Firmicutes bacterium CAG:646 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093485 URS0000D8D6B4_1665556 URS0000AB33BE_1643452 URS000232C2AE_1262995
Length 187. 187. 187. 188.
Similarity - 0.955 0.955 0.952
Ensemble Norm 0.975 - - -
MFE -63.298 -51.022 -51.022 -39.157
Ligands - lysine lysine cobalamin
Gene RSRC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 12. 9.005
Length SE - 0. 0. 1.
Lev Distance - 54. 54. 59.
UBS 13. 11. 11. 15.
BS 0. 0. 0. 0.
ILL 3. 1. 1. 4.
ILR 1. 2. 2. 2.
H 6. 5. 5. 5.
BL 3. 4. 4. 4.
BR 3. 2. 2. 4.
UN 0.112 0.112 0.112 0.181

Sequences

Field Description
UTR seq + 25 gaugcacucgauaucucggcugaagcugccuggcgcuagaaccaggaaggcgcugagcuuaaacugaagcaaguucgguggacgccggcggcgcccugaucuaaagaaacgacucagggacugcggcgcuugcacgucaacgggaggugugagcccaaagaaATGGGACGTCGGTCATCAGATACTG
UTR dot + 25 …………..((((((….(((.(((((……..)))))..)))))))))((…((((((…..)))))))).((((.((((..((((((((………)).)))))).))))))))(((((((.((…..)).)))))))((((……))))..(((……..)))….
RS 1 seq AGUGAUGAUAGAGGUGCGAACUUCAAAAGUAUGUAAUCGGAGAAGAUAGAGCUUCCGAGAUGAUUACGGAAAGGGGAGGAUCGCCGAAGUAAAAAAAAGUCUCUUUUUCUUUUUUUUACUGGUUCUGCGUUUAAGAAAUGUAGGACUGUCAGGUUGUCUUUGUGCUGCCUGGAGAGCUAUCUCACCG
RS 1 dot ………….(.((((.((((…….(((((((((.((((……)))))….))))))))…….)))).)))))..((((((((((((………))))))))))))((((((((((((…))))))))))))..(((((.((……)).)))))((((….))))….
RS 2 seq AGUGAUGAUAGAGGUGCGAACUUCAAAAGUAUGUAAUCGGAGAAGAAAGAGCUUCCGAGAUGAUUACGGAAAGGGGAGGAUCGCCGAAGUAAAAAAAAGUCUCUUUUUCUUUUUUUUACUGGUUCUGCGUUUAAGAAAUGUAGGACUGUCAGGUUGUCUUUGUGCUGCCUGGAGAGCUAUCUCACCG
RS 2 dot ………….(.((((.((((…….(((((((((.((((……)))))….))))))))…….)))).)))))..((((((((((((………))))))))))))((((((((((((…))))))))))))..(((((.((……)).)))))((((….))))….
RS 3 seq UUUAAUUGAAUAUGAUGAGGUUCCUGUGUUUUUUCUCCACAGGCUAAGAGGAAAGAGGGGUUUCAUUCCCCCGCGGUCACGCCGCUGUAAAGGACGAGUCUGUUUCAUUCAUGUCACUGGGAAACUGGGAAGGCGAAACAGUAUGAAGACUCCCGAGCCAGAAGACCUGCCCGUCAUAGGAAAUUUAC
RS 3 dot ………….(((((((..(((.(.((((((((((…))…)))))))).).))))))))))…..(((((…)))))……((..(((((((((((..((…((.((((….)))))).)).))))))…….)))))))..(.(((…..))))((……))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table