Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093486 Similarity: 0.952 Similarity: 0.952 Similarity: 0.949
UTR: 5HSAA093486
Gene: RSRC1_1
MFE: -61.963
ENS: 0.759
Length: 174.
Predicted Ligands:
lysine - 7/20
FMN - 6/20
Mg2+ - 3/20
 RS: URS0000AB530E_246196
MFE: -61.551
Ligand: Mg2+
Species: Mycobacterium smegmatis str. MC2 155 M-box riboswitch (ykoK leader)
 RS: URS0000AB58A8_882378
MFE: -73.533
Ligand: FMN
Species: Burkholderia rhizoxinica HKI 454 FMN riboswitch (RFN element)
 RS: URS0000C03CA8_1121326
MFE: -39.804
Ligand: lysine
Species: Clostridium magnum DSM 2767 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093486 URS0000AB530E_246196 URS0000AB58A8_882378 URS0000C03CA8_1121326
Length 174. 174. 175. 174.
Similarity - 0.952 0.952 0.949
Ensemble Norm 0.759 - - -
MFE -61.963 -61.551 -73.533 -39.804
Ligands - Mg2+ FMN lysine
Gene RSRC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 3. 17.
Length SE - 0. 1. 0.
Lev Distance - 61. 61. 57.
UBS 16. 16. 15. 13.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 2. 1. 1. 0.
H 5. 6. 5. 5.
BL 7. 6. 7. 5.
BR 7. 6. 8. 7.
UN 0.092 0.075 0.114 0.103

Sequences

Field Description
UTR seq + 25 cugccuggcgcuagaaccaggaaggcgcugagcuuaaacugaagcaaguucgguggacgccggcggcgcccugaucuaaagaaacgacucagggacugcggcgcuugcacgucaacgggaggugugagcccaaaggucuggacccagaaATGGGACGTCGGTCATCAGATACTG
UTR dot + 25 ((.(((((……..))))).)).(((((.((.(..((((((…..))))))..).)))))))(((((((((((………)).)))))).).))((.((((((((.((…..)).))))))))))….(.((((.((((….))))…)))).)………..
RS 1 seq ACCGCGCUUCGUUAGGUGAGGCUCCUACACGAACACAGGCCACUGAUCCGACGACGUCGAGAGACGCCCAGGGUUAGGACAGAUCUUCCCGGCCUAAGGGAUGAUCCGAAGUGGCUUCCCACCUCAAGGUGGGACACGUCGUGCAGUGCCAAAGCUCUGAUGAGGAAGUGCUCG
RS 1 dot .(((.(.(((((((((…….)))).)))))).).))…(((((((…(.((((….)))))…)))))))….((((.((((…….)))).))))(((.(((…(((((((….)))))))))).)))..(((.((….)).)))..(((……))).
RS 2 seq AUGCGUCUUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAUGCCGCGCACCGGUCCUUCGGCCGGCGCGCGACGAGCCCGCGAGCGCCGAUGCGUCGUGCAAACGCCGCGUCGGGUCAGCAGAUCUGGUGCGAUGCCAGAGCCGACGGUCAUAGUCCGGAUGAGAGAAGAUGUGA
RS 2 dot …………((.((((…….)))).)).(((((.((.(((((.((((((….)))))).))))).)).))).))…..((((((((.(((….))).))))))))(((.((…((((((…..)))))))).)))..(((((.(((……).))…)))))
RS 3 seq AUGUGAUACAGAGGCCGCGGUUGUCAUUAGUAUUGUGUGUUUUCUUAAAUGAACAUUCAAGAAAGGGUCACUCGCCGAAAUGCAUGAAAUAGAUCAUGUGUUGGGAUUAUACUGAAUAAGUAUAGUACUGUCUUCAGAAAGUUGCCCGAUUUUCUAAAGAAGUGCUUAUCAUGU
RS 3 dot ….(((((((.(((…….))).)).)))))((((.(((((((.(((….))).))))))).).)))…((..(((((((((……))))))))).))..((((((…..))))))(((((.((((.((((((((….)))))))).)))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table