Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093492 Similarity: 0.972 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA093492
Gene: RSRC1_2
MFE: -35.154
ENS: 0.977
Length: 119.
Predicted Ligands:
methionine - 15/20
TPP - 3/20
Ni/Co - 1/20
 RS: URS0000C7D7C8_665007
MFE: -48.364
Ligand: methionine
Species: Streptomyces incarnatus S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D6BFFA_12908
MFE: -24.789
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000C38730_285458
MFE: -48.814
Ligand: methionine
Species: Streptomyces agglomeratus S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093492 URS0000C7D7C8_665007 URS0000D6BFFA_12908 URS0000C38730_285458
Length 119. 117. 121. 117.
Similarity - 0.972 0.972 0.971
Ensemble Norm 0.977 - - -
MFE -35.154 -48.364 -24.789 -48.814
Ligands - methionine Ni/Co methionine
Gene RSRC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 7. 3.001
Length SE - 4. 4. 4.
Lev Distance - 31. 29. 32.
UBS 11. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 2. 3. 1. 2.
H 3. 3. 3. 3.
BL 4. 5. 4. 4.
BR 6. 5. 5. 5.
UN 0.134 0.068 0.116 0.103

Sequences

Field Description
UTR seq + 25 gagcuuaaacugaagcaaguucgguggacgccggcggcgcccugaucuaaagaaacgacucagggacugcggcgcuugcacgucaacgggagaaATGGGACGTCGGTCATCAGATACTG
UTR dot + 25 ..((((……))))…(((.((.(((((.((((.((((((((((………)).)))))….))).)))).))..))).)).)))….((((((….))).)))…….
RS 1 seq GGUCAUGAGUGACAGUCAUGAGGCCCCGGCCGGCUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAAGACCAGGCCGUAGGCAGCGAGGUCUACGGCAAGCGCGGACC
RS 1 dot ..((((((…….)))))).(((.(((((((((.(((((((.(((.((……)).))).))))..)))…)).)).)))))..)))…..(((((.((…..)).)))))
RS 2 seq ACAGUACAAACUGAGCAGACCGAGAUUAUCAUAUAUAACAAUUUUUAACUAAGCUUAUUGUAUAAUCCUGGAGUCGGGUCACACGCGUGACAGUGGAAUCUUUUCUAUCCACGGGACAGUA
RS 2 dot .((((….))))….((((..((((.((((((((((.((.(((…..))).)).)))))))….))))))).))))…(.((((…((((((….)))))).)))).)……
RS 3 seq GGUCAUGAGUGACAGCGUUUUGGCCCCGGCUUGCUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAAGACCAGGUCGUGGACAGAAAGGUCCACGGCAAGCGCGGACC
RS 3 dot .((((….))))…(((((.((((.(((.(.(((((((((……..).))).))))).).)))..)))).)))))(..(((((((((……)))))))))..)……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table