Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093526 Similarity: 0.986 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA093526
Gene: RTBDN
MFE: -26.635
ENS: 0.796
Length: 84.
Predicted Ligands:
cyclic-di-GMP - 10/20
guanidine - 4/20
zmp-ztp - 4/20
 RS: URS00021EDF12_12908
MFE: -40.990
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS000232D57A_52770
MFE: -37.431
Ligand: zmp-ztp
Species: Actinomyces hordeovulneris ZMP/ZTP riboswitch
 RS: URS0000AB22D9_546414
MFE: -19.933
Ligand: cyclic-di-GMP
Species: Deinococcus deserti VCD115 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093526 URS00021EDF12_12908 URS000232D57A_52770 URS0000AB22D9_546414
Length 84. 84. 84. 84.
Similarity - 0.986 0.984 0.984
Ensemble Norm 0.796 - - -
MFE -26.635 -40.990 -37.431 -19.933
Ligands - guanidine zmp-ztp cyclic-di-GMP
Gene RTBDN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.007 9.001 7.004
Length SE - 0. 0. 0.
Lev Distance - 16. 19. 20.
UBS 5. 3. 5. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 0.
ILR 2. 1. 2. 2.
H 1. 2. 1. 2.
BL 3. 1. 1. 4.
BR 0. 0. 1. 1.
UN 0.179 0.095 0.214 0.119

Sequences

Field Description
UTR seq + 25 augaagagugagaaagcugucuaggugccuguccaauuagggcaguaggaagaauccugATGGACGAAGCCCTAGAAACGCAGC
UTR dot + 25 ……………((((((((((.((.(((((.(((((((…………))))))))))))..)))))))….)))))
RS 1 seq UGUAUUUUGCCGCCGGGCAAAAUAAAGACGCCCCUGCUUGUAUCGUAGGCCUUAGAAGAUACAGGCAACGGGCGUCUUUAUUUU
RS 1 dot ……..(((….)))(((((((((((((((.((((((((((………….))))))))))..)))))))))))))))
RS 2 seq CUAUCCCGUCGCAACUGGCGAGGGUGGACACCACCGGGGAGCGGCAACCUGACGCCUGACCGGUCGUCCGCCUGGGCCGGGAAG
RS 2 dot …………..(((((..((((((((…(((((((.(((………)))))..))))).))))))))..)))))….
RS 3 seq AUAACGGCACGAAGCAAUGAAAUGUUCGAUGUAACCGGGCACCUAUCGAACAUGGAGCUAGUGGUGCGACCGACGUUUCAUACG
RS 3 dot ……((…..)).((((((((.(((.(((.(((((((.((……….)).)))..)))))))..)))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table