Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093834 Similarity: 0.983 Similarity: 0.980 Similarity: 0.978
UTR: 5HSAA093834
Gene: RXFP2
MFE: -11.260
ENS: 0.984
Length: 96.
Predicted Ligands:
glycine - 16/20
preQ_1 - 1/20
TPP - 1/20
 RS: URS0000C219E3_1262915
MFE: -19.909
Ligand: glycine
Species: Phascolarctobacterium sp. CAG:266 Glycine riboswitch
 RS: URS0000ABCF2B_869312
MFE: -24.153
Ligand: preQ_1
Species: Streptococcus pneumoniae SPN033038 preQ1-II (pre queuosine) riboswitch
 RS: URS0000C63136_1712028
MFE: -13.946
Ligand: glycine
Species: Psychrobacillus sp. FJAT-21963 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093834 URS0000C219E3_1262915 URS0000ABCF2B_869312 URS0000C63136_1712028
Length 96. 95. 97. 95.
Similarity - 0.983 0.980 0.978
Ensemble Norm 0.984 - - -
MFE -11.260 -19.909 -24.153 -13.946
Ligands - glycine preQ_1 glycine
Gene RXFP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.027 10.001 12.073
Length SE - 1. 1. 1.
Lev Distance - 21. 23. 24.
UBS 5. 6. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 0. 1. 2.
H 2. 3. 2. 1.
BL 2. 1. 0. 0.
BR 2. 3. 0. 1.
UN 0.396 0.232 0.433 0.126

Sequences

Field Description
UTR seq + 25 ugaacuuacuacaucagaacuccugcugagguauaagaggauacgucuaauaacucaauugcuguaaaccuATGATTGTTTTTCTGGTTTTTAAAC
UTR dot + 25 ….((((.(((.((((……..)))).)))))))……………………….(((((…((…….)).)))))……
RS 1 seq GGACACAUCUCUGGAGAAUCCCACUAAAAGGGUGCCGAAGGUGCACGGGGAAGCAACGCCCCUUAUCUCUCAGGCCAAAGGACAGAGCUUUAAGC
RS 1 dot …..(((((.(((…((((……..)))).))).)))))…((((……..))))………(((((……..).))))…..
RS 2 seq UGUGCUAUACUAGUAGGGUUGAAUAAAGCAACCCUUGGUGCUUAGCUUCUUUCACCAAGCAUAUUACACGCGGGCAACCGCCAAAGGAGAAAAGAUG
RS 2 dot …(((((((((..(((((((…….))))))))))))..))))…………………..((((….))))…………….
RS 3 seq AUGAGGAUACGGGGAGAGAACGCCUAAAGUGCGUCGCCGAAGGAGCAAGUAAAGAAAUUUAUGAAUCUCUCAGGCAAAAGAACUCGUAUAGGACG
RS 3 dot ……((((((((((((((((((….).))))………………………….))))))………..)))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table