Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093838 Similarity: 0.986 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA093838
Gene: RXRB
MFE: -19.076
ENS: 0.772
Length: 74.
Predicted Ligands:
cobalamin - 6/20
homocysteine - 5/20
SAM - 3/20
 RS: URS0000BF0F28_1538295
MFE: -21.538
Ligand: SAM
Species: Aquabacterium sp. NJ1 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C7E6AE_1660144
MFE: -27.112
Ligand: homocysteine
Species: Thiobacillus sp. SCN 65-179 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C2C8B4_1869167
MFE: -14.936
Ligand: fluoride
Species: Humibacillus sp. DSM 29435 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093838 URS0000BF0F28_1538295 URS0000C7E6AE_1660144 URS0000C2C8B4_1869167
Length 74. 75. 74. 74.
Similarity - 0.986 0.984 0.983
Ensemble Norm 0.772 - - -
MFE -19.076 -21.538 -27.112 -14.936
Ligands - SAM homocysteine fluoride
Gene RXRB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.045 3. 3.005
Length SE - 1. 0. 0.
Lev Distance - 17. 21. 22.
UBS 6. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 1. 2. 2. 2.
H 1. 1. 1. 2.
BL 2. 2. 2. 2.
BR 3. 2. 2. 2.
UN 0.108 0.320 0.095 0.176

Sequences

Field Description
UTR seq + 25 caauauggcggcacuccgguagcgacgaauccauccugcacugacacgcATGTCTTGGGCCGCTCGCCCGCCCT
UTR dot + 25 ……(((((……….((((((..((((.(.(((……..))).)…)))).)).)))))))))..
RS 1 seq GAUACCUAUAGCGCCGAUUUGUCCGGAUUGCGGGCGCUCAAGAAAUUCCGCUAAAGAGGGCGCUGCACACCGGCC
RS 1 dot ………………….((((..(((((((.(((.((……..))…))).)).)))))..))))..
RS 2 seq CGGUUUCGAGGAGCGCUGCGACGGUUCACCCGCCAGGCUCGAUUCCGGCGAUGUUUCAACGGCGCUCGUUGACG
RS 2 dot …..((((.((((((((….((..((..((((.((…….)))))).))..))..)))))))).))))..
RS 3 seq CUGAGAGAAGGUGAUGGACCCCGCCUGGGUGGUGACAGCCCUAACUGCAUUUUGCUGAUGGUUCCUACGACGUU
RS 3 dot ……..(((((……..)))))..((.(((..((((….(.(((…))).)..))))..))).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table