Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093953 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA093953
Gene: SAAL1
MFE: -23.054
ENS: 0.783
Length: 75.
Predicted Ligands:
fluoride - 8/20
homocysteine - 3/20
cobalamin - 2/20
 RS: URS0000C512DF_1411621
MFE: -24.225
Ligand: fluoride
Species: Hymenobacter sedentarius Fluoride riboswitch
 RS: URS000080E282_1488
MFE: -22.632
Ligand: GMP
Species: c-di-GMP-II riboswitch from Clostridium acetobutylicum (PDB 3Q3Z, chain V)
 RS: URS000232F525_1618586
MFE: -13.366
Ligand: cobalamin
Species: Candidatus Woesebacteria bacterium GW2011_GWC2_31_9 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093953 URS0000C512DF_1411621 URS000080E282_1488 URS000232F525_1618586
Length 75. 76. 75. 75.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.783 - - -
MFE -23.054 -24.225 -22.632 -13.366
Ligands - fluoride GMP cobalamin
Gene SAAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.003 2.040 4.002
Length SE - 1. 0. 0.
Lev Distance - 20. 22. 22.
UBS 5. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 3.
ILR 2. 2. 1. 3.
H 1. 1. 1. 1.
BL 1. 0. 1. 0.
BR 1. 1. 1. 0.
UN 0.213 0.158 0.013 0.173

Sequences

Field Description
UTR seq + 25 cuccuccgcagcuuccggcacggccuucaagcgcgggacgcgacaaagucATGGACCGCAACCCCTCGCCGCCGC
UTR dot + 25 ……………((((..(((……..((((..((.(((…))).))..))))……..))))))).
RS 1 seq UCCAAACCCGGUGAUGGGGUACCACCUUGAACCGCCAGUGCCUUUGGGGCGCUGCGCUGAUGACUCCUACGCCUAC
RS 1 dot ………((((..(((((..((………((((((((((…)))))))).))))…)))))..))))…
RS 2 seq GCGCGGAAACAAUGAUGAAUGGGUUUAAAUUGGGCACUUGACUCAUUUUGAGUUAGUAGUGCAACCGACCGUGCU
RS 2 dot ((((((………….(.((((……..((((((((((((…)))))))..))))))))).))))))).
RS 3 seq GUGUUAAUAAAUUUGGUGAAUCACGGUGAAAUUCCGUGGGAGUGCCGCUACUGUAAACCCAGAACCCACUAAAAC
RS 3 dot ………..(((((((..((..(((……..((((…..))))……..)))..))…)))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table