Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA093999 Similarity: 0.973 Similarity: 0.970 Similarity: 0.968
UTR: 5HSAA093999
Gene: SAFB2
MFE: -50.602
ENS: 0.840
Length: 129.
Predicted Ligands:
cobalamin - 13/20
FMN - 3/20
SAM - 2/20
 RS: URS0000AB8008_12908
MFE: -28.521
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000ABC967_12908
MFE: -24.621
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000AB3FCD_12908
MFE: -32.422
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA093999 URS0000AB8008_12908 URS0000ABC967_12908 URS0000AB3FCD_12908
Length 129. 129. 129. 129.
Similarity - 0.973 0.970 0.968
Ensemble Norm 0.840 - - -
MFE -50.602 -28.521 -24.621 -32.422
Ligands - cobalamin cobalamin cobalamin
Gene SAFB2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 10.001 8.005
Length SE - 0. 0. 0.
Lev Distance - 32. 36. 39.
UBS 10. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 5. 1.
ILR 4. 2. 4. 3.
H 2. 2. 2. 2.
BL 2. 3. 1. 4.
BR 3. 5. 3. 2.
UN 0. 0.023 0.023 0.070

Sequences

Field Description
UTR seq + 25 gaaacgagugcguuuuccucuuaggcggcgccauuuuguguucagagccgcuauagcugccggcggugugcgacugagucgguggcgaagacgggaacgcgacgATGGCGGAGACTCTGCCCGGGTCGG
UTR dot + 25 ((((((….))))))((.(((.((((((((((((((((((((….(((((…((((((((((((…..)))..)))))))))..)).))))))))))).)))))))……))))).)))..))
RS 1 seq GUAUUGAAUCUUGGUGGGGAAUCAGUGUGAAAUUCAUUGGCUCUUCCUGGAACCGUAAAGUCGGAGUGCCACCCAAUAUAGUCCGCUGUUGAAUGAUGGCCAGGAAAAGUCUAGUUCUACGAUUUUAAU
RS 1 dot .((((((.((((….)))).))))))(((((((.(((((((.(((((((..((((….((((((((..((……..)).)))).))))…))))))))))).)).)))))…..)))))))..
RS 2 seq GUACUGAAGUUUGGUGGGGAAUCAGUGUGAAAUUCAUUGGCUCUACCUGGAACCGUAAAGUCGGAGCGCCACCCAGUAUAGUCCGCUGUUGAAUGAUGGCCAGGGAAAGUCUAAUUCUACAAUUUUAAU
RS 2 dot .((((((..(((….)))..))))))(((((((.(((((((…(((((..((((….((((((((..((……..)).)))).))))…)))))))))…)).)))))…..)))))))..
RS 3 seq GUAUUGAGUCUUGGUGGGAAAUCAGUGUGUAAUUCAUUGGCUCUUCCUGGAACCGUAUAGUCGGAGUGCCACCCAAUAUAGUCCGCUGUUGAAUGAUGGCCAGGAAAAGUCUAGUUCUGCAAUGAAAAA
RS 3 dot .((((((.((((…))))..))))))…..((((((((((.(((((((..((((((((.((((.((……….)).))))))))……))))))))))).)))………)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table