Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094036 Similarity: 0.975 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA094036
Gene: SALL4
MFE: -43.658
ENS: 0.778
Length: 126.
Predicted Ligands:
SAM - 10/20
glycine - 6/20
FMN - 2/20
 RS: URS0000C67CCF_242161
MFE: -42.109
Ligand: glycine
Species: Candidatus Burkholderia calva Glycine riboswitch
 RS: URS0000C5DEA4_888050
MFE: -45.925
Ligand: FMN
Species: Actinomyces cardiffensis F0333 FMN riboswitch (RFN element)
 RS: URS0000C3C496_1090379
MFE: -42.542
Ligand: glycine
Species: Burkholderia sp. BR2009044596 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094036 URS0000C67CCF_242161 URS0000C5DEA4_888050 URS0000C3C496_1090379
Length 126. 126. 126. 127.
Similarity - 0.975 0.973 0.973
Ensemble Norm 0.778 - - -
MFE -43.658 -42.109 -45.925 -42.542
Ligands - glycine FMN glycine
Gene SALL4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 11. 4.
Length SE - 0. 0. 1.
Lev Distance - 32. 30. 33.
UBS 12. 11. 13. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 4.
ILR 2. 2. 2. 1.
H 3. 3. 3. 3.
BL 5. 5. 5. 4.
BR 4. 3. 7. 4.
UN 0.071 0.079 0.079 0.055

Sequences

Field Description
UTR seq + 25 augcgcguuccggccgaagggggguaaauuucccaacuccaggaauuuguggcggagagggcaaauaacugcggcucucccggcgccccgaugcucgcaccATGTCGAGGCGCAAGCAGGCGAAAC
UTR dot + 25 ..(((.(((((((….((..(((…….)))..)))).))))).))).(.((((((.(((……)))..)))))))..((((….((((.((.((…….)).)).))))))))….
RS 1 seq UCCCCGCACUCUGGAGAGCGGCAGCGGCUUUCACCGGCAAGCUGCCCACCGAAGGGGCGCGUGAUGAACCGUCGGCAACAAGACAGUUCGCGCAAUCUCUCAGGUACCGAAGACAGAGGGGUCACG
RS 1 dot ….(((.((((((…(.((((((.(((……)))..))))))).))..))))))).(((.(((((.(((……..))).)))))))).(((((((..((…….)).)))))))….
RS 2 seq AGUCAGCUCCGGGGUCGGUGUAAUUCCGAACCGGCGGUGAAAGUCCGCGACCCGCUCGCAUAGAGGGCGGUUGAAUCGGUGUAAUUCCGAUACCGACGGUGAAAGUCCGGAUGGGAGGAGCAUGAG
RS 2 dot ..(((.(.((((..((((…….)))).)))).).)))….(((((((((.(((…..))).).)))))…)))(((..((((.((.(((((…….))).)))).))))..)))….
RS 3 seq UCCCCGUACUCUGGAGAGCGGCAGCGGCUUUCAACCAGCAAGCUGCCCACCGAAGGGGCGCGCGAUGAACCGUCGGCAGUAAGACAGUUCGCGCAAUCUCUCAGGUACCGAGAACAGAGGGGUCACG
RS 3 dot .((((….((.((…(.((((((.(((…….)))..))))))).)))).)))).((((((…((.(((……..))).)))))))).(((((((..((…….)).)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table