Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094042 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA094042
Gene: SAMD11
MFE: -35.393
ENS: 0.908
Length: 114.
Predicted Ligands:
TPP - 17/20
SAM - 1/20
glycine - 1/20
 RS: URS0000C15866_76728
MFE: -47.118
Ligand: TPP
Species: Streptomyces vitaminophilus TPP riboswitch (THI element)
 RS: URS0000DCC0BB_44250
MFE: -25.255
Ligand: TPP
Species: Paenibacillus alvei TPP
 RS: URS0000AB3AB2_944559
MFE: -25.738
Ligand: TPP
Species: Paenibacillus sp. HGF7 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094042 URS0000C15866_76728 URS0000DCC0BB_44250 URS0000AB3AB2_944559
Length 114. 114. 114. 113.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.908 - - -
MFE -35.393 -47.118 -25.255 -25.738
Ligands - TPP TPP TPP
Gene SAMD11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 3.006 3.
Length SE - 0. 0. 1.
Lev Distance - 29. 32. 31.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 3.
ILR 3. 3. 2. 4.
H 2. 2. 2. 2.
BL 3. 3. 2. 3.
BR 1. 1. 1. 1.
UN 0.140 0.105 0.061 0.150

Sequences

Field Description
UTR seq + 25 ccaacgaguuccaguucgucagcggccgcgagacggccaaggacuggaagcgcagcauccgccacaaagggaaaagucugaagacgcuuATGTCCAAGGGGATCCTGCAGGTGC
UTR dot + 25 ……..(((((((((……(((((…..)))))..)))))))))..((((.((((.((……(((.((((……..))))…)))..)))))).))))……
RS 1 seq CAGGACAUCCGCGGGAGCCCGGGCGCAACCGGGCUGAGAGUGGGGCUGGGCGGCCCCUGACCGUACGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGCAGGUUCCCCCAUGG
RS 1 dot …….(((((…(((((((……)))))))….)))))..((((.((..((((.((.(…..(((…((((……))))…)))).))))))..))))))…
RS 2 seq UCAUACAAAUUCGGGGGCUUGAGGAAUCAGGCUGAGAUUGUAGAUGAGUAUACCGCUACUGACCGUGAAUCUGAUCUGGAUAAUGCCAGCGUAGAGAAUCUGUAUUUGUCGUGU
RS 2 dot …(((((.(((…(((((((….)))))))))).)))))((((((((((…………..((.((((..((((……))))..))))…))))))))))))….
RS 3 seq AAUAAGACGCAGGGGUGCUGGAAUCGGCCGGCUGAGAUUGUAUCCCAUAAAGAUACUGACCCUUACACCUGAUCUGGAUAAUGCCAGCGUAGGAAACCGUACGGAUACUAUCG
RS 3 dot ………..(((((((.((..((((….))))..)))))))))…..((((…..((.(((.((((..((((……))))..))))…..))).))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table