Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094053 Similarity: 0.969 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA094053
Gene: SAMD13
MFE: -24.134
ENS: 0.930
Length: 125.
Predicted Ligands:
TPP - 8/20
guanidine - 4/20
glycine - 3/20
 RS: URS0000ABBB5A_656519
MFE: -29.999
Ligand: molybdenum
Species: Halanaerobium hydrogeniformans Moco (molybdenum cofactor) riboswitch
 RS: URS0000C076BD_157072
MFE: -39.486
Ligand: TPP
Species: Aphanomyces invadans TPP riboswitch (THI element)
 RS: URS0000D99462_1802005
MFE: -42.113
Ligand: guanidine
Species: Pseudomonadales bacterium RIFCSPHIGHO2_02_FULL_60_43 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094053 URS0000ABBB5A_656519 URS0000C076BD_157072 URS0000D99462_1802005
Length 125. 124. 125. 126.
Similarity - 0.969 0.967 0.966
Ensemble Norm 0.930 - - -
MFE -24.134 -29.999 -39.486 -42.113
Ligands - molybdenum TPP guanidine
Gene SAMD13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 6.014 10.005
Length SE - 1. 0. 1.
Lev Distance - 37. 43. 41.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 1.
ILR 1. 3. 2. 2.
H 3. 3. 3. 3.
BL 0. 1. 1. 2.
BR 2. 0. 2. 2.
UN 0.144 0.129 0.264 0.214

Sequences

Field Description
UTR seq + 25 cuuuagguuuaaucacaucucuccaaucgccgagggaacuggagauuuaaacaaacauacgugaacuguugcugaaguaaaggaacccugcagccuucccATGCTATCTGTTGACATGGAAAACA
UTR dot + 25 .(((((((((..(((..((((((……..))))))..))))))))))))………..(((..(((((……………..))))).)))((((((……..).)))))……
RS 1 seq UAUUAGUAAUACCUUCGAGUUUUUCUGCCUAAAGAAAAUAGCUUUCUAAGGUGGCUAAACCGAUGGGUUGAGAAAGAAAUGACUCAGCCUCCCGUGCUUGGAAAGAAGAGUAAUCUUAAGGAGG
RS 1 dot ..(((((..((((((.((((((((((……))))))..))))…)))))))))))..((..((((((((……….))))))))..))(((((……..)))))…………
RS 2 seq GAAACCAGCGAGGGGUGCCAUUGGAGUAUACCCUUGUCCAUGGGUAUCAUUCCUUUGGCUGAGAUCAUACCCUAAAUUACCUGAUCCGGGUUAUACCGGCGGAGGGACUGCUGCGUUGUUGCUAC
RS 2 dot ………..(((((((((..(((((((((((……..)))))).)))))..))))………)))))…………((((……))))((.((……)).))……….
RS 3 seq GCAAUGGUCGACUAGGGUUCCGGUUCGCUGAGCAAUGCCUGCAGCGAAUGGCUGGUCCGAGAGUCGACGACCUCACGCAGUGGCCACGGCCAAGGGGUUACACGGCGGGAUAAAAGCCCGGGAGAA
RS 3 dot ……(((((((.(((..(((((((((((((……)).))))))…))))))))…)))))))………..((((((.(……).))))))….((((…….))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table