Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094086 Similarity: 0.963 Similarity: 0.963 Similarity: 0.961
UTR: 5HSAA094086
Gene: SAMD8
MFE: -65.169
ENS: 0.811
Length: 132.
Predicted Ligands:
cobalamin - 6/20
TPP - 6/20
molybdenum - 2/20
 RS: URS0000AB5D74_256318
MFE: -55.601
Ligand: homocysteine
Species: metagenome sequence S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C7CD4A_69222
MFE: -43.354
Ligand: molybdenum
Species: Erwinia mallotivora Moco (molybdenum cofactor) riboswitch
 RS: URS000232A66B_262209
MFE: -50.230
Ligand: cobalamin
Species: Janibacter melonis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094086 URS0000AB5D74_256318 URS0000C7CD4A_69222 URS000232A66B_262209
Length 132. 130. 132. 130.
Similarity - 0.963 0.963 0.961
Ensemble Norm 0.811 - - -
MFE -65.169 -55.601 -43.354 -50.230
Ligands - homocysteine molybdenum cobalamin
Gene SAMD8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 26. 10.008 15.006
Length SE - 4. 0. 4.
Lev Distance - 33. 46. 41.
UBS 11. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 1. 4. 3.
ILR 7. 5. 5. 4.
H 2. 2. 2. 2.
BL 3. 6. 4. 2.
BR 0. 3. 2. 2.
UN 0.038 0.038 0.129 0.115

Sequences

Field Description
UTR seq + 25 acuccggcgaggcggggagggccccggacuccgacggcggcucggacgccgacucggagguggguccggggagcccgacucggaccgcggaggcagcggaggaggaaATGGCAGGTCCTAATCAACTCTGCA
UTR dot + 25 .((((.(((.(.((((..(((((((((((((((((((((…….)))))..)))))…..)))))))..))))..))))..))))))))…((((((..((….((…..))…))..)))))).
RS 1 seq CCCGCCGAGGGGCGCUGCGACCAUGGACCUGCGGCCCGAGCCGCGAAGCCGCGCACACGUCCGUGCGCGCCUGCGAUCCCUGGCCAGGCUCGGCAGGGCGUUCCUUCAGCGACAACGGCGCCCGGACCAA
RS 1 dot ((.(((.((((((((.(((..(((((((.((((((.((…..))..))))))…..)))))))..)))..))).))))))))..))…(((.(((((((…………..))))))).).))..
RS 2 seq UGCGGUAAGUCACACUUAGCCCUGGCACCUAAGUCUGCGGAUAGGGUGCCCCGGCCGCAACUGUUGUUGCCAGGGUGCAGAAAGAAAUGCCUGCAUCUCCCGUCUCUGGAAAGGUGUACUGGUGCCACAAUU
RS 2 dot …((((..((…((..((((((((((…(((.(((((.(.(((…))).)))))))))…)).))))))))..))…))..))))(((((((.(((….)))..)))))))…………..
RS 3 seq CUUCGUGGUUGUGAGAGGAUCGCGCCCGGCGCAGCCAACCGAGGAAUCCGGUGCGAAUCCGGAGCGGUCCCGCCACUGUCACGGCCCCCUGGGGCCCGAGCCAGACACUCGGUCUGCACCCGUCACCGUC
RS 3 dot ..((((((..(((.(.(((((((..(((((((…..((((…….)))))))…)))).))))))))..)))..))))))…..(((((((((((…….)))))…)).))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table