Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094413 Similarity: 0.961 Similarity: 0.959 Similarity: 0.958
UTR: 5HSAA094413
Gene: SAR1A
MFE: -31.280
ENS: 0.931
Length: 136.
Predicted Ligands:
cobalamin - 7/20
FMN - 7/20
TPP - 4/20
 RS: URS000231B872_584657
MFE: -58.749
Ligand: cobalamin
Species: Intrasporangium sp. Q5-1 Cobalamin riboswitch
 RS: URS0000C5CDF2_1736516
MFE: -58.804
Ligand: FMN
Species: Yonghaparkia sp. Root332 FMN riboswitch (RFN element)
 RS: URS0000C411FA_217031
MFE: -33.353
Ligand: FMN
Species: Bacillus galactosidilyticus FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094413 URS000231B872_584657 URS0000C5CDF2_1736516 URS0000C411FA_217031
Length 136. 135. 137. 135.
Similarity - 0.961 0.959 0.958
Ensemble Norm 0.931 - - -
MFE -31.280 -58.749 -58.804 -33.353
Ligands - cobalamin FMN FMN
Gene SAR1A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.033 5.066 22.028
Length SE - 1. 1. 1.
Lev Distance - 46. 52. 47.
UBS 8. 11. 8. 11.
BS 0. 0. 1. 0.
ILL 2. 2. 2. 3.
ILR 0. 0. 1. 2.
H 2. 3. 3. 4.
BL 3. 5. 4. 3.
BR 2. 3. 3. 4.
UN 0.309 0.126 0.051 0.141

Sequences

Field Description
UTR seq + 25 uagcuggcggucccgggugcugcugggcugcuuccaaccuucaauuuguaaaaaaaccagaaaaccucaggauccacaaaguaucaucaaaugagguaguaagcauuaauaATGTCTTTCATCTTTGAGTGGATCT
UTR dot + 25 …..(((((.(((((……))))))))))……………………………….((((((((………(((…(((((.(.(((((((…)))).))).)))))))))))))))))
RS 1 seq CACAGUCGCUGCCCCGCUAGGGUGGCGGCAGCGUCAUCGACCAGGAACCCGGUGUGAGUCCGGGACGGUCCCGCCACUGUGAGCGCGCCACGCGUGGCCGCGUGAGUCAGGAACUGCCGGCGGCGUGUCACAUCC
RS 1 dot ….(.(((((((((((….)))).))))))).)…((((.(…(((((…….))))).)))))…….(((((.((((((…….((((.((.(((…..))))))))))))))))))))…
RS 2 seq AACGCACUUCGGGGUCGGUGAAAGUCCGAGCCGGCGGUCAUAGUCCGCGACCCGUGGUCGAGCUCUCGGGCUCGGCACCGGUUGAGCUGGUGGAACUCCAGCACCGACGGUGAGAGUCCGGAUGGGAGAAGUGCGGU
RS 2 dot ..((((((((.((.((((…….)))).)).((((…….))))..(((((……….((((((((..((((.((((.(((((…….)))))..)))))))).))))))))))))).))))))))..
RS 3 seq AUUCAUCUUCGGGGCGUGGUGAAAUUCCCGACCGGCGGUAAUGAAACAACGGUUUCUAAGCCCGCGAGCUUCUUUGAAGCAGGAUUUGGUGUGAUUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGAAGAUGGAG
RS 3 dot ……..((((((.((……))))))))…((((….((((……))))…..))))..(((((…)))))…..((.((.(..(((((…(((((……))).)).)))))..).)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table