Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094425 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA094425
Gene: SAR1A_0
MFE: -24.235
ENS: 0.944
Length: 80.
Predicted Ligands:
glycine - 11/20
SAM - 4/20
homocysteine - 1/20
 RS: URS0000ABC536_1664069
MFE: -21.792
Ligand: glycine
Species: Bacillus glycinifermentans Glycine riboswitch
 RS: URS0000D861BB_1793963
MFE: -23.992
Ligand: glycine
Species: Bacillus nakamurai Glycine riboswitch
 RS: URS0000C6CD8B_666686
MFE: -19.292
Ligand: glycine
Species: Bacillus sp. 1NLA3E Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094425 URS0000ABC536_1664069 URS0000D861BB_1793963 URS0000C6CD8B_666686
Length 80. 80. 80. 80.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.944 - - -
MFE -24.235 -21.792 -23.992 -19.292
Ligands - glycine glycine glycine
Gene SAR1A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 4.001 4.001
Length SE - 0. 0. 0.
Lev Distance - 19. 19. 19.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 0. 0. 0.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 2. 3. 3. 3.
UN 0.188 0.225 0.225 0.225

Sequences

Field Description
UTR seq + 25 guacauccggcgaguagcuggcggucccgggugcugcugguaguaagcauuaauaATGTCTTTCATCTTTGAGTGGATCT
UTR dot + 25 .(((..(((((.((((.((((…..)))).)))))))))..)))…………((((((((….)))).))))..
RS 1 seq GGAGCAGCUUCUGGAGAGACCGCGGAAUUCUGCGGCGCCGAAGGGUUCACAAUCUCAGGCAAAAGGACAGAAGAGUACCG
RS 1 dot .((((..((((.((…(.((((((….))))))).)))))).))))…………….((((……)).)).
RS 2 seq GGAGCAGCUUCUGGAGAGACCGCGGAAUUCCGCGGCGCCGAAGGGUUCACAAUCUCAGGCAAAAGGACAGAAGAGUACCG
RS 2 dot .((((..((((.((…(.((((((….))))))).)))))).))))…………….((((……)).)).
RS 3 seq GGAGCAGCUUCUGGAGAGAUCGCAAUUAUUUGCGACGCCGAAGGGUUCACAAUCUCAGGCAAAAGGACAGAAGAGUACCG
RS 3 dot .((((..((((.((.(…((((((….))))))).)))))).))))…………….((((……)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table