Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094521 Similarity: 0.949 Similarity: 0.949 Similarity: 0.949
UTR: 5HSAA094521
Gene: SAT1
MFE: -54.493
ENS: 0.729
Length: 190.
Predicted Ligands:
cobalamin - 15/20
TPP - 2/20
glucosamine - 1/20
 RS: URS000231B7D5_1570360
MFE: -63.566
Ligand: cobalamin
Species: Roseovarius sp. A-2 Cobalamin riboswitch
 RS: URS0002311F4B_338966
MFE: -53.674
Ligand: cobalamin
Species: Pelobacter propionicus DSM 2379 Cobalamin riboswitch
 RS: URS0002325845_403957
MFE: -35.784
Ligand: cobalamin
Species: Virgibacillus sp. SK37 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094521 URS000231B7D5_1570360 URS0002311F4B_338966 URS0002325845_403957
Length 190. 190. 192. 191.
Similarity - 0.949 0.949 0.949
Ensemble Norm 0.729 - - -
MFE -54.493 -63.566 -53.674 -35.784
Ligands - cobalamin cobalamin cobalamin
Gene SAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 5.002 9.007
Length SE - 0. 4. 1.
Lev Distance - 60. 59. 61.
UBS 14. 16. 15. 15.
BS 1. 0. 0. 0.
ILL 4. 3. 3. 6.
ILR 4. 3. 4. 4.
H 3. 3. 4. 4.
BL 6. 8. 5. 5.
BR 5. 6. 5. 4.
UN 0.116 0.147 0.156 0.031

Sequences

Field Description
UTR seq + 25 cgcgggccgacugguguuuauccgucacucgccgagguuccuugggucauggugccagccugacugagaagaggacgcucccgggagacgaaugaggaaccaccuccuccuacuguucaaguacaggggccugguccgcaaagggaagaaaagcaaaagacgaaaATGGCTAAATTCGTGATCCGCCCAG
UTR dot + 25 .((((((((..((((.(((((.((((.((((..(((..(((((.(((((.(((….)))))))).)….))))..))).)))).)))).)))))..))))((.(((..((((…..)))).)))))..))))))))………….((…..(((((……….)))))…..))….
RS 1 seq GCCAGUAAUCGUCGCGUCGGUUUCCAUAGGGAAUGAAAAGGGAAUCCGUUCCGGCCUCGGCCGGCAAACGGAACUGCCCCCGCAACUGUAGGCGGCGAGUGCCUCUCGACAAGCCACUGGGACCAUCCCGGGAAGGCGAGAGCUGCGACGACCCGUCAGUCAGGAGACCUGCCGACGAAAUUGAAACCAC
RS 1 dot ….(((.(((((((.((((((.(….(((……..((.(.(((((((((((….)))))..))))))..).)))))).))))).).))))))).)))(((((…..(((.((((((…))))))…))))))))………..((((.(.((((…))))).))))………….
RS 2 seq AGCAUCAUAUCGGAUCACGGUGCCCGCAAGGGCUUGAUAGGGAAGAGGGGUGCAACUCUUAUACGAGCCAUUCCCCCGCGGACCCGCCGCUGUAAGCGAUGACGAAGGGCAGUAUGCCACUGGUGAACAACCGGGAAGGCGCCCGGAGGAUGACUCGCAAGCCAGAAGACCUGCCUGAUCUUUACCACUGAC
RS 2 dot …….(((((..((((((((.((((((.((((((.((…(((((……..))))).)))))))).))…..))))…))))).)).)..)))))…..((((…..(((.(((((…..)))))…))))))).(((…..)))……..(((((.(…..).)))))………
RS 3 seq AUAUAGUGUUUUGGUUAUGGUUACACCAUUCGUGUUUAAAAGGGAAUCCAGUGAAAUUCUGGAACUGUACCCGCAACUGUAAUUGUGACGAACGAGAUGAUUCCACUGUUUGAGAUGUCUAUUGAGCAAAUGGGAAGGACUCUAGUAGAAAGACCAAAAGUCAGGAUACCUGCCAUAACUUGUAGUUUCCA
RS 3 dot .(((..(((((..((((((((((((…..((.((…..(.((..(((((…….))))).)).))).))….)))))))))))))))))..))).(((((.(((((((……..)))))))..)))))..((((…((……))….)))).(((.(.((((……..))))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table