Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094532 Similarity: 0.938 Similarity: 0.937 Similarity: 0.937
UTR: 5HSAA094532
Gene: SAT1_0
MFE: -36.489
ENS: 0.812
Length: 206.
Predicted Ligands:
cobalamin - 12/20
unknown - 5/20
TPP - 2/20
 RS: URS0000E608FA_1230342
MFE: -47.778
Ligand: unknown
Species: Clostridium tetanomorphum DSM 665 raiA RNA
 RS: URS0000E60116_1122184
MFE: -65.306
Ligand: unknown
Species: Lutispora thermophila DSM 19022 raiA RNA
 RS: URS0000D9E4EF_1805004
MFE: -64.948
Ligand: SAM
Species: Anaerolineae bacterium CG2_30_58_95 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094532 URS0000E608FA_1230342 URS0000E60116_1122184 URS0000D9E4EF_1805004
Length 206. 207. 205. 203.
Similarity - 0.938 0.937 0.937
Ensemble Norm 0.812 - - -
MFE -36.489 -47.778 -65.306 -64.948
Ligands - unknown unknown SAM
Gene SAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 4. 6.006
Length SE - 1. 1. 9.
Lev Distance - 74. 81. 67.
UBS 13. 13. 14. 13.
BS 0. 0. 0. 1.
ILL 3. 5. 4. 5.
ILR 5. 5. 4. 5.
H 3. 5. 4. 3.
BL 4. 3. 4. 4.
BR 4. 2. 4. 3.
UN 0.107 0.097 0.093 0.030

Sequences

Field Description
UTR seq + 25 gggcaaugcugcuucuucugacucaacaaauggggagagcaaauugaaaaugcguaaauuggaaggcaaguucugaaauuaaacguuguacuuuggccugauguucugaccuuuaaggaagcaagaguuuguaaacuuccaaauauuuacuauucugaacugccguguaaaccugacguauATGGCTAAATTCGTGATCCGCCCAG
UTR dot + 25 …((((..(((.((((((.(………).))))))))).))))…….(((((((((((((((((((((….(((((.((((.((………..))..)))).)))))…….)))))))))…))))))…))))))…((((((..((((((((………))))))))….)))).))………
RS 1 seq UUGAGUUAGGUUUGUGAUUGAAAGUCGAAGCCAGUCGCAGGCGAAACGAUCCACGUAAGUUAAAUAAAAUAUUUAAUGAUCAUGGUGCGGCUUAGAAGUAAGUCCUGCCGUUAAUUAAACGAGAGGGUAAGUAGUGAGAGGAUAAUUCUGGGUAGCAAAAGCUCCAGCAGGCGAGUGUGGGGUCAAAGAUCAGGUCAACUAACUUAA
RS 1 dot ….(((..(((((((((((………..)))))))))))..)))…(((…..((((((((…))))))))…..)))(((.((((((((….(((((..(((((.(((..(….)..))).)))))..)))))..)))))))).)))…((((((.((……))))))))……..((((……))))..
RS 2 seq AUUUCCCAGGUCUGUGGUUGAAAAUCGAUGCCAGUCGCAGGCAAAACGAUCCACGUAAGCAAAGCAAAGCUUUGUGAGCAUGGUGCGGCUUAGGAGUAAGUCCGUCCAGGUUAUACCUGAGAGGAGCUGUAGUGAGGGGCUUAAUAGCUUGAGCGAAACUUCCAGACGGCGAGUGUGGGGGCAAAGACCAGGUCAGCUGUGGAAA
RS 2 dot ………(((((((((((………..)))))))))))….((..(((.((..(((((((…)))))))..)).)))..))(((((((..(((((((.(((((((…)))))…………..)).)))))))….)))))))…..((((..(((((((.(.(((………))).))).))))))))).
RS 3 seq CUCUUAUCCAGAGAGGCGGAGGGACCGGCCCGAUGAUGCCUCAGCAACCUGUUUUAGUUCGGUAGUUGGAUAGUUAGGUAGUUCGAUAGUCAAGUACGCAACUAAACAACCACACAACUACAAAACUAUAGAACUAAAGCGAGGUGCUAAUUCCGGCAGUAGGGGUAAUCCUGUGAGAUUACCCAAAUUCUGGAAGAUGAGAG
RS 3 dot ((((((((….((((((..(((…..)))…..))))))(((.((((((((((((((.((((((…(((((..((.(((…((((……….))))…))).))..)))))…)))))).)))))))))).)))))))..((((((.(((..((((((((……))))))))..)))))))))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table