Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094554 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA094554
Gene: SATL1
MFE: -9.969
ENS: 0.994
Length: 58.
Predicted Ligands:
fluoride - 13/20
glutamine - 6/20
cobalamin - 1/20
 RS: URS0000C7E9F2_1619033
MFE: -19.219
Ligand: cobalamin
Species: Candidatus Yanofskybacteria bacterium GW2011_GWE2_40_11 Cobalamin riboswitch
 RS: URS0000C2E490_12908
MFE: -8.526
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C4F98A_12908
MFE: -9.526
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094554 URS0000C7E9F2_1619033 URS0000C2E490_12908 URS0000C4F98A_12908
Length 58. 58. 59. 59.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.994 - - -
MFE -9.969 -19.219 -8.526 -9.526
Ligands - cobalamin glutamine glutamine
Gene SATL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.076 2.032 2.032
Length SE - 0. 1. 1.
Lev Distance - 15. 16. 16.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0. 0.224 0.322 0.322

Sequences

Field Description
UTR seq + 25 ggacugagccaaccaguccugaggcaaccaaacATGAACCAATCAGGCACGAACCAAT
UTR dot + 25 ((((((…….))))))……………………..((……))…
RS 1 seq GCUGGUGAGAAUCCAGCACUGUCGCGCAACGGUAAUCCCCUCCUUGGGGUAAGUCCGG
RS 1 dot (((((…….)))))…………(((….((((…..))))…..))).
RS 2 seq AUCGUUCAUCCUUAUUUGGGGACGGAAGUAGGUAAAAAAUCAAACCGAAGGAACGCAUC
RS 2 dot .((((((..((……))))))))…..(((……….)))………….
RS 3 seq AUCGUUCAUCCUUGUUUGGGGACGGAAGUAGGUGAAAAAUCAAACCGAAGGAACGCAUC
RS 3 dot .((((((..((……))))))))…..(((……….)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table