Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094950 Similarity: 0.945 Similarity: 0.944 Similarity: 0.943
UTR: 5HSAA094950
Gene: SCFD1
MFE: -40.891
ENS: 0.952
Length: 195.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
FMN - 1/20
 RS: URS000231D235_1797224
MFE: -91.642
Ligand: cobalamin
Species: Alphaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_63_12 Cobalamin riboswitch
 RS: URS000232A732_457429
MFE: -90.226
Ligand: cobalamin
Species: Streptomyces pristinaespiralis ATCC 25486 Cobalamin riboswitch
 RS: URS000231F76F_1965650
MFE: -66.588
Ligand: cobalamin
Species: Alistipes sp. An66 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094950 URS000231D235_1797224 URS000232A732_457429 URS000231F76F_1965650
Length 195. 195. 195. 195.
Similarity - 0.945 0.944 0.943
Ensemble Norm 0.952 - - -
MFE -40.891 -91.642 -90.226 -66.588
Ligands - cobalamin cobalamin cobalamin
Gene SCFD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.007 10.004 2.001
Length SE - 0. 0. 0.
Lev Distance - 68. 69. 76.
UBS 14. 15. 14. 14.
BS 0. 0. 2. 0.
ILL 4. 2. 4. 4.
ILR 3. 3. 3. 3.
H 3. 4. 4. 4.
BL 4. 6. 3. 4.
BR 3. 4. 5. 4.
UN 0.128 0.046 0.067 0.159

Sequences

Field Description
UTR seq + 25 agcaaucagcgagauuccgugggcguaggacccucugagccaggugugggauauagucucguggugcgccguuucuuaagccggucugaaaagcgcaauauucggguggaagugacccgauuuuccaggcaagaaaauuggauguauauuuugaauaugaagaaaaaauaATGCCAACTGAAGAAAATATTGACA
UTR dot + 25 .((.((((.((((((((((..(((.((((….)))).)))…..))))…..)))))))))))).(((((((((..(((.(…(((((………((((((…….)))))))))))).)))))))))..)))..(((((((((…………)))))).)))…………………
RS 1 seq UGUAGGGUCGCGGGCGACGGUGCCUUCCCCCAGGGAGGGAGAAUAGGGAACGCGGUUUAAAUCCGCGGCUGUGCCCGCAACUGUAAGCGGCGAGCGAUCCUCCGAAUUGGUCACUGGGCCGCCUGCCGGCCCGGGAAGACCGGAGAUCGCGACGACCCGCGAAGCCAGGAGACCUGCCGUCGGCGUCGUCCUUUU
RS 1 dot .(((.(((((((((.(((.((((((((((…)))))))………..))).)))….))))))))).)))((((……..))))…(((((.((((…..((((.((((((((…..))))))))…)))))))))))))(((((((((((..(.((((…))))))).))).))))))…..
RS 2 seq UUACUGUCACGGGGCCUUGGUGUUCGGGAAACCGGUGCGGUACCGGUGCGGCCCUCGCCACUGUGAUCGGGAAGUCCGGCUCCACCCCCUCACGGGGAGCCACUGGGACACCGCGCGACGCGCGGUGCCCGGGAAGGCGGAGUCCGGGCGGCAUGACCCGUCAGCCAGGAGACCGGCCAGGGUGCGUUGUCCAUC
RS 2 dot …(((((((((…..(((((…(((..(((((((…)))))))….))).))))))))))).)))…((((((((((..((((….)))).(((.(((((.((((((((…)))))))))))))…))))))).))))))((((((((((….(((.((…)))))..)))).))).)))….
RS 3 seq UAUCUUUGCUCCGGAUUUGGUUUCCUGCUCCCCGUGCGGGGAGGGAAUGAAAAGGGAACCGGGUGCAAGUCCCGGACAGUCCCGCUGCUGUGAAACUCCGCGGACGUUCCGAACAUCUCGCCACUGAUCCUCCGCGAUCGGGAAGGCUUCGGAACGGGAGUAAGUCAGAAGACCUGCCAAAUCAAUUCGGUUCCG
RS 3 dot …………(.((((((((((((.((((((….)))))).)……..))))))))))).)..((((((((..((..(((….)))..)))))).))))((((((((……(((.((((((……))))))…)))))))))))((.((…(((….))))).))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table