Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094987 Similarity: 0.984 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA094987
Gene: SCHIP1
MFE: -19.799
ENS: 0.785
Length: 91.
Predicted Ligands:
GMP - 5/20
TPP - 5/20
glycine - 3/20
 RS: URS0000C15E69_1154860
MFE: -18.990
Ligand: Mg2+
Species: Streptococcus agalactiae LMG 14747 THF riboswitch
 RS: URS0000C1E036_1215092
MFE: -35.795
Ligand: glycine
Species: Pseudomonas alcaligenes NBRC 14159 Glycine riboswitch
 RS: URS0000D67F2B_12908
MFE: -38.683
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094987 URS0000C15E69_1154860 URS0000C1E036_1215092 URS0000D67F2B_12908
Length 91. 91. 91. 91.
Similarity - 0.984 0.982 0.982
Ensemble Norm 0.785 - - -
MFE -19.799 -18.990 -35.795 -38.683
Ligands - Mg2+ glycine GMP
Gene SCHIP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.020 10. 3.002
Length SE - 0. 0. 0.
Lev Distance - 21. 21. 24.
UBS 6. 6. 7. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 2. 0. 1.
H 3. 3. 3. 3.
BL 1. 1. 3. 0.
BR 1. 0. 3. 1.
UN 0.209 0.066 0.187 0.165

Sequences

Field Description
UTR seq + 25 cuuucaaagccaauuugaauaaacaacucuucccucucaaaugggcaagaguaacucuucagcaccATGGTACATCAGGATAACTGCTCGT
UTR dot + 25 ..((((((…..))))))……(((((((((……..))).))))))……..((((((.((……))))…..))))…
RS 1 seq GACAGAGUAAAUGAUUUGCGUCAAGUGUAUGUGAAUGGGAUGUUGUCACAUAACGAAACGAAGCGUGCGAUAAAUCAUUGCAUCCGCUGUU
RS 1 dot ..((((……..))))(((…((.(((((((………..)))))))))…))).((((((((((…..))))))..))))…
RS 2 seq CGCGCCCUCGCAGGAGAGCGAGGCGCCCGAUGCGCCUCCGCCGAAGGCGCAAACUCCCAUGAUCGCUCAGGCCCAGCACUGCGAGAUUCCG
RS 2 dot .(((.((((((……)))))))))….(((((((…….)))))))………((((.(.(((((…)).))).).))))…
RS 3 seq CACGAGGGUAGAGGCCUUGAUACCCGCCCCGCAACACCCCGAGGCACCUACGGGGCGGGAGGAGCCAGUGGUGCGACCGGCUACCGCUACG
RS 3 dot ..(((((…….)))))…(((((((((…..((….))……)))))))))…….((((((((…..)).))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table