Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA094989 Similarity: 0.981 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA094989
Gene: SCIN
MFE: -33.278
ENS: 0.866
Length: 93.
Predicted Ligands:
glycine - 11/20
SAM - 4/20
GMP - 2/20
 RS: URS0000D9C6F8_1121421
MFE: -19.644
Ligand: glycine
Species: Desulfotomaculum aeronauticum DSM 10349 Glycine riboswitch
 RS: URS0000D69946_12908
MFE: -30.031
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C30B9C_1203606
MFE: -22.461
Ligand: glycine
Species: Butyricicoccus pullicaecorum 1.2 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA094989 URS0000D9C6F8_1121421 URS0000D69946_12908 URS0000C30B9C_1203606
Length 93. 93. 93. 94.
Similarity - 0.981 0.977 0.977
Ensemble Norm 0.866 - - -
MFE -33.278 -19.644 -30.031 -22.461
Ligands - glycine GMP glycine
Gene SCIN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 2.023 3.
Length SE - 0. 0. 1.
Lev Distance - 25. 30. 29.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 2. 0. 1.
H 3. 3. 3. 3.
BL 3. 3. 3. 3.
BR 3. 2. 2. 4.
UN 0.054 0.097 0.204 0.064

Sequences

Field Description
UTR seq + 25 cugcugcucucgguuuaguccaagaucagcgauaucacgcgucccccggagcaucgcgugcaggagccATGGCTAAACTATACATGGTTTCAG
UTR dot + 25 .(((((.(((.((……)).))).)))))….(((((((((…)))….))))))(.(((((((((………..))))))))).)
RS 1 seq GGACAGGACUCUGGAGAGACCCGUUUUUAGGGCGCCGAAGGGGCAAUACAAAUUGCUGUUAAAUCUCUCAGGCAAAAGGACAGAGGAGGAUUA
RS 1 dot …..((.(((((((((……)))))))))..))..((.((((((….)))))).)).((((((((.(………).)))..))))).
RS 2 seq GCGCAAGGUAGAGGCUAAGAACCCCGCCCUACGGAAGAUACGGGCACCCGAGAGGGCCUGGGGGAGCCAGUGGUGCGACCGGCUACCUUCUAU
RS 2 dot …….((((.(((……….)))))))………((((.((…..))))))(((((((((.((……)).)))).)))))…
RS 3 seq GGAUGUGGCUCUGGAGAAUCCCAACCAUGGGUGCCGAAGGUGCAAGGUGCAGAAAAUGCGCUAAUCUCUCAGGCAAAAGGACAGAGUGGAUUUU
RS 3 dot …((((.((.(((…..((((….))))..))).)).)))).((((((…..))))))((((((((.(………).))).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table