Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095125 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA095125
Gene: SCO1
MFE: -30.235
ENS: 0.916
Length: 86.
Predicted Ligands:
zmp-ztp - 6/20
glycine - 5/20
homocysteine - 3/20
 RS: URS0000C69EA6_1504156
MFE: -34.745
Ligand: zmp-ztp
Species: Microbacterium sp. SUBG005 ZMP/ZTP riboswitch
 RS: URS0000C06979_1704277
MFE: -30.970
Ligand: zmp-ztp
Species: Deinococcus sp. UR1 ZMP/ZTP riboswitch
 RS: URS000233056B_249408
MFE: -30.595
Ligand: zmp-ztp
Species: Deinococcus marmoris ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095125 URS0000C69EA6_1504156 URS0000C06979_1704277 URS000233056B_249408
Length 86. 86. 86. 87.
Similarity - 0.985 0.984 0.983
Ensemble Norm 0.916 - - -
MFE -30.235 -34.745 -30.970 -30.595
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene SCO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 5.003 4.001
Length SE - 0. 0. 1.
Lev Distance - 18. 20. 20.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 3.
ILR 3. 3. 4. 3.
H 1. 1. 1. 1.
BL 1. 3. 2. 2.
BR 3. 3. 2. 4.
UN 0.058 0.070 0.116 0.034

Sequences

Field Description
UTR seq + 25 ggaagcggaacgcuaccggaaaucgcggggagggucaaaggagacccggucuccgaggcucATGGCGATGCTGGTCCTAGTACCCG
UTR dot + 25 …..(((…((((((((..(((((.(…(((((…((((((…))))))..))))).).))))).)))))…)))..)))
RS 1 seq UGGCACCGUCGCGACUGGCGUUGAGGUGGGACACCACCGGGGAGCGACCGCUUGACGGUAUUCGACCGCACGCCUGGGUCGAUGCG
RS 1 dot ……(((..(((((((((.((.(((.(((….((((..((((….))))..)))).))).))).))))))..)))))..)))
RS 2 seq GAGUGCGGGGGCGACUGGCGCUGAACGUGGGCUGACCACGGGGGAGCCUCCGGAAGAGUGAAUGAUCGCGCGCCUGGGUCGAACGG
RS 2 dot ……..(..(((((((((((((.(((..(((…(.(((((….))))))…)))..))).))).)))))..)))))..)..
RS 3 seq ACAGCGGACGGCAACUGGCGCUGAACGUGGGCCAACCACGGGGAAGCCGCUCCGAAUUCCAUUUGAUCGCGCGCCUGGGUCGGACGU
RS 3 dot …(((..((((..(.((((((((.((((((…….(((((……)))))…)))))..).))).))))).).))))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table