Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095135 Similarity: 0.989 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA095135
Gene: SCOC
MFE: -10.542
ENS: 0.880
Length: 70.
Predicted Ligands:
fluoride - 15/20
homocysteine - 2/20
preQ_1 - 1/20
RS: URS0000D66FB4_12908
MFE: -13.
Ligand: preQ_1
Species: unclassified sequences preQ1-III riboswitch
RS: URS0000D9CF69_1805276
MFE: -23.587
Ligand: fluoride
Species: Nitrospirae bacterium CG1_02_44_142 Fluoride riboswitch
RS: URS0000BEE004_134537
MFE: -20.340
Ligand: fluoride
Species: Burkholderia fungorum Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095135 URS0000D66FB4_12908 URS0000D9CF69_1805276 URS0000BEE004_134537
Length 70. 70. 70. 71.
Similarity - 0.989 0.987 0.987
Ensemble Norm 0.880 - - -
MFE -10.542 -13. -23.587 -20.340
Ligands - preQ_1 fluoride fluoride
Gene SCOC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.003 2.002 3.005
Length SE - 0. 0. 1.
Lev Distance - 15. 17. 16.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 1. 1. 0.
H 1. 1. 1. 2.
BL 1. 1. 0. 0.
BR 1. 0. 0. 1.
UN 0.243 0. 0. 0.169

Sequences

Field Description
UTR seq + 25 acuuccgguuaagaaugcaacacucaggucugaaaauugaacaagATGCGCAGGCGTGTATTCTCGAGTC
UTR dot + 25 ………..(((((((…….(.(((((…(((……)))…))))).))))))))……
RS 1 seq AAGCAACUUAGGAUUUUAGGCUUCGCCCCUGCGGCGUCACCGUGCAAACGGCAAAAUCCGGAAAAGAGAA
RS 1 dot ……….(((((((…….(((..(((.(((….))))))…))))))))))………..
RS 2 seq AAUUUAAAAGGCGAUGGAGUUCGCCGCUAACCGCUCCGAUAAUAUCGGGGCCGAUAACUCCUGCCACCCC
RS 2 dot ………((((..((((((((………((((((((…)))))))))))..)))))))))…..
RS 3 seq GCUCAAUCUGGAGAUGGCGUUCCUCCUUUAACCAUCGCGCUUACCGCGCGGUUAAUGACGCCUACAGUUAC
RS 3 dot .(((……)))..((((((……((((((…((((…..)))))))))).))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table