Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095200 Similarity: 0.961 Similarity: 0.958 Similarity: 0.958
UTR: 5HSAA095200
Gene: SCRN1
MFE: -45.750
ENS: 0.844
Length: 161.
Predicted Ligands:
FMN - 7/20
Mg2+ - 4/20
molybdenum - 3/20
 RS: URS0000ABC7A6_634177
MFE: -67.243
Ligand: FMN
Species: Gluconacetobacter xylinus NBRC 3288 FMN riboswitch (RFN element)
 RS: URS0000C66C43_1077974
MFE: -62.655
Ligand: FMN
Species: Gordonia effusa NBRC 100432 FMN riboswitch (RFN element)
 RS: URS0000D94CB2_265960
MFE: -61.558
Ligand: FMN
Species: Gluconacetobacter nataicola FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095200 URS0000ABC7A6_634177 URS0000C66C43_1077974 URS0000D94CB2_265960
Length 161. 161. 162. 160.
Similarity - 0.961 0.958 0.958
Ensemble Norm 0.844 - - -
MFE -45.750 -67.243 -62.655 -61.558
Ligands - FMN FMN FMN
Gene SCRN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.015 7.011 9.028
Length SE - 0. 1. 1.
Lev Distance - 51. 52. 52.
UBS 9. 10. 11. 11.
BS 0. 1. 0. 1.
ILL 4. 3. 3. 4.
ILR 3. 3. 4. 4.
H 3. 4. 4. 4.
BL 2. 2. 2. 3.
BR 2. 1. 2. 3.
UN 0.255 0.130 0.148 0.087

Sequences

Field Description
UTR seq + 25 auauuagauaauggagaagcaaauggcaaggaugguuaccuuggcuaccaagauaaagaaccuugaaaagggaagaagaugaaaucagcuucggauaucaggcaggcagcugggucugugggucagaggcuuaaggATGATAAGCAGACCCGCCTGGCTCT
UTR dot + 25 ……………………..(((((….(((.(((((…))))).)))….)))))……((((..(((…)))..))))…….((.(((((….((((((((..((((…………))))..))))))))))))).))..
RS 1 seq AGGCGUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUGAUUGCACCCUUUUGCAAGGGGCAUAAGUCCGCGAGCGCCCGGCCCCCUCUGGGGCCGGGGUCAAGCAGAUCCGGUGUGAUUCCGGAACCGACGGUUACAGUCCGGAUGAAAGAGAACGGAA
RS 1 dot …(((((((..((.((((…….)))).)).((((….(((.(((((….))))))))…..))))..(..(((((((((….)))))))))..)……(((((((((((..(((…….))))))))..))))))….)))))))…
RS 2 seq UGUAGUUCUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUGAUUGUUGUAGCUGAAGUUCAGUGGCAACACAGCCCGCGAGCGCCUGCCCAACUGGGCAGGGACAAGCAGAUCCGGUGUGAUUCCGGAGCCGACGGUCAUAGUCCGGAUACGAGAGAACCGGU
RS 2 dot …………((.((((…….)))).)).((((….((((((.(((((…))))).))))))….))))..(..(((((((….)))))))..)……..((((((((..(((((((((…)))…..)))))))))……))))).
RS 3 seq AGACGUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAUUGGUCCUGCAUGCAGGGCCAUAAGUCCGCGAGCGCCCGACCGCGAAAGCGGGCGGGGUCAAGCAGAUCCGGUGCAAUUCCGGAACCGACGGUUACAGUCCGGAUGAGAGAGAACGGAA
RS 3 dot …(((((((..((.((((…….)))).)).((((….((((((((….))))))))…..))))..(..((((.((((….)))).))))..)…(..((((((.((….(((…….)))…..))))))))..).)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table