Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095244 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA095244
Gene: SCUBE2
MFE: -37.082
ENS: 0.807
Length: 105.
Predicted Ligands:
TPP - 8/20
fluoride - 6/20
tetrahydrofolate - 2/20
 RS: URS0000C1B377_1423724
MFE: -23.314
Ligand: tetrahydrofolate
Species: Lactobacillus apodemi DSM 16634 = JCM 16172 THF riboswitch
 RS: URS000015E9ED_326423
MFE: -16.362
Ligand: TPP
Species: Bacillus amyloliquefaciens FZB42 TPP riboswitch (THI element)
 RS: URS0000D88F72_1552
MFE: -21.199
Ligand: TPP
Species: Clostridium estertheticum subsp. estertheticum TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095244 URS0000C1B377_1423724 URS000015E9ED_326423 URS0000D88F72_1552
Length 105. 105. 104. 105.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.807 - - -
MFE -37.082 -23.314 -16.362 -21.199
Ligands - tetrahydrofolate TPP TPP
Gene SCUBE2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 4.001 13.
Length SE - 0. 1. 0.
Lev Distance - 32. 33. 31.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 2.
ILR 1. 1. 2. 3.
H 2. 2. 2. 2.
BL 4. 3. 4. 2.
BR 5. 4. 4. 3.
UN 0.152 0.095 0.183 0.171

Sequences

Field Description
UTR seq + 25 ggcguccgcgcacaccuccccgcgccgccgccgccaccgcccgcacuccgccgccucugcccgcaaccgcugagccauccATGGGGGTCGCGGGCCGCAACCGTC
UTR dot + 25 ((((.(.((((……….)))).).))))……(((((((((((.(…….(((.((….)).).))…….)))))).))))))……….
RS 1 seq GUAGGGGUAGGAAUUUAUGCGUUACGGGCUUGUGGAACGGAAUGUGAACACAGGCAGAAAGCUAAACCGUCAUUUUAGCUGCGUGUAUCUUCCGCAUUCACCAAU
RS 1 dot (((((.((((….)))).).))))……(((((.(((((…((..(((.((….(((((((…….))))))))).))).)))))))..)))))….
RS 2 seq AAAAGUCACUAGGGGAGCUUUAAUAGCUGAGAAGAGACAAUACGUCCUGACCCUUUGAACCUGAUUUGGUUAAUACCAGCGUAGGGAAGUGAAAAAUUAGAGAG
RS 2 dot ….(((.((…..((((…..))))….)).)))..(((.((((.((.((…((((……))))……)).)).)))).)))………….
RS 3 seq AAUAUGUGCUAGGGGUGCCUUAUGGCUGAGAUAUGAAUAUUCAAUUCAUUGACCCUUAUACCUGAUCUGGAUAAUACCAGCGGAGGAAAGCGGUAAUGAUGUAUA
RS 3 dot .((((.(((((((….)))…)))..).))))………..(((((.((((((…(((…((((……))))…))).))).))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table