Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095245 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA095245
Gene: SCUBE2_0
MFE: -29.027
ENS: 0.823
Length: 103.
Predicted Ligands:
TPP - 5/20
glycine - 5/20
SAM - 4/20
 RS: URS0000C084EF_888061
MFE: -34.593
Ligand: TPP
Species: Desulfomicrobium orale DSM 12838 TPP riboswitch (THI element)
 RS: URS0000D99EAC_1517881
MFE: -29.969
Ligand: SAM
Species: Cellulosimicrobium sp. CUA-896 SAM riboswitch (S box leader)
 RS: URS00023180C1_264251
MFE: -29.966
Ligand: SAM
Species: Cellulosimicrobium funkei SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095245 URS0000C084EF_888061 URS0000D99EAC_1517881 URS00023180C1_264251
Length 103. 103. 103. 103.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.823 - - -
MFE -29.027 -34.593 -29.969 -29.966
Ligands - TPP SAM SAM
Gene SCUBE2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.008 10. 10.
Length SE - 0. 0. 0.
Lev Distance - 27. 28. 28.
UBS 10. 8. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 1.
ILR 3. 3. 3. 3.
H 2. 2. 2. 2.
BL 4. 3. 5. 5.
BR 4. 3. 5. 5.
UN 0.068 0.155 0.078 0.078

Sequences

Field Description
UTR seq + 25 cguccgcgcacaccuccccgcgccgccgccgccaccgcccgcacuccgccgccucugcccgcaaccgcugagccauccATGGGGGTCGCGGGCCGCAACCGTC
UTR dot + 25 …..((((……….))))((..((.(((..(((((.((…….(.(((.((……..)).))))……)).))).))..))).))…))..
RS 1 seq ACAACAAGCUGGGGGAGCCCGCAGGGGCUGAGAGGGGAGUGCAUCCCGACCCUUUGAACCUGACGCAGUUCAUACUACCGGAGGGAAGCUGACUCGCCACUCG
RS 1 dot ……………(((((….)))))(((.((.((((((.((((..(….(((((……..)))))…….)..)))).))..)))).)).))).
RS 2 seq CCACCAUCCAGAGCGGUCGAGAGUCCUGGCUCGACGACACCGCAGCAACCCGCCGACGGAAGCCUCCCGAGGACAAAGGUGCUAACGCCAGGGUCGAUGGAGU
RS 2 dot …….((((.((……..)).))))(((.(((((.(((((((.(((.(((..(((…….))).)).)…))))))…))..)))))).).))).
RS 3 seq CAACCAUCCAGAGCGGUCGAGAGUCCUGGCUCGACGACACCGCAGCAACCCGCCGACGGAAGCCUCCCGAGGACAAAGGUGCUAACGCCAGGGUCGAUGGAGC
RS 3 dot …….((((.((……..)).))))(((.(((((.(((((((.(((.(((..(((…….))).)).)…))))))…))..)))))).).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table