Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095308 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA095308
Gene: SCYL2
MFE: -16.357
ENS: 0.986
Length: 75.
Predicted Ligands:
cobalamin - 9/20
GMP - 6/20
Ni/Co - 4/20
 RS: URS0000D9050D_642780
MFE: -35.674
Ligand: cobalamin
Species: Marmoricola sp. Sco-D01 Cobalamin riboswitch
 RS: URS0000D66689_12908
MFE: -35.113
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-GGC riboswitch
 RS: URS0000C7AEA4_12908
MFE: -25.435
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095308 URS0000D9050D_642780 URS0000D66689_12908 URS0000C7AEA4_12908
Length 75. 74. 76. 75.
Similarity - 0.985 0.984 0.983
Ensemble Norm 0.986 - - -
MFE -16.357 -35.674 -35.113 -25.435
Ligands - cobalamin GMP Ni/Co
Gene SCYL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4. 6.004
Length SE - 1. 1. 0.
Lev Distance - 17. 19. 21.
UBS 5. 4. 6. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 1. 0.
H 3. 3. 3. 4.
BL 2. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.160 0.162 0.145 0.227

Sequences

Field Description
UTR seq + 25 uuggacacuacucuaggaccggguaacuauaacuacccaauauugcagccATGGAGTCCATGCTTAATAAATTGA
UTR dot + 25 (((((……)))))….(((((……..)))))..(((((.((.(((((…))))))))))))……
RS 1 seq GGAAGCCGGUGGGAAUCCGGCACAGUCGCGCUACUGUGACACCGCUCCCGAACCUGGGGGCGGUGGAGUCAGAC
RS 1 dot (((..((….))..)))..((((((……)))))).(((((((((((….)))))))))))………
RS 2 seq GUCCGAAAGGGCAGACUGUCGGCGACGGCAGGACGCGAAGCCUCCGGGCUCGCAAGAGCUAGCGGGGCCGCCAGGA
RS 2 dot ((((….))))…((((((….))))))…(((..(((.((((((((….)))))..)))))))))…..
RS 3 seq ACAGUACAAGCUGAUCAGGCCGUAAAACCGGCCGGGCCUUACGGCAGCAGAUUAUCCUACAUCUGCGGGACAGGA
RS 3 dot .((((….))))….(((((……)))))..(((….))).((((((……..))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table