Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095323 Similarity: 0.963 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA095323
Gene: SDAD1
MFE: -43.265
ENS: 0.892
Length: 144.
Predicted Ligands:
FMN - 7/20
cobalamin - 4/20
molybdenum - 3/20
 RS: URS0000C62998_1577905
MFE: -51.813
Ligand: FMN
Species: Tateyamaria sp. ANG-S1 FMN riboswitch (RFN element)
 RS: URS0000C71048_12908
MFE: -29.511
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C5151B_12908
MFE: -29.211
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095323 URS0000C62998_1577905 URS0000C71048_12908 URS0000C5151B_12908
Length 144. 145. 144. 144.
Similarity - 0.963 0.959 0.959
Ensemble Norm 0.892 - - -
MFE -43.265 -51.813 -29.511 -29.211
Ligands - FMN glutamine glutamine
Gene SDAD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.003 9.008 9.008
Length SE - 1. 0. 0.
Lev Distance - 43. 52. 52.
UBS 8. 10. 7. 7.
BS 0. 0. 0. 0.
ILL 4. 5. 2. 2.
ILR 2. 4. 3. 3.
H 2. 3. 3. 3.
BL 2. 0. 1. 1.
BR 2. 3. 1. 1.
UN 0.257 0. 0.167 0.167

Sequences

Field Description
UTR seq + 25 gcgcuauuuccggucauacccggaaacacgaguccaagcugcagcuggcagggauugcggggugccggccgucugaguuuuuuuaaaacugcucgccgcgaagucugucugcagccaaaATGTCCAACAGAAACAACAACAAGC
UTR dot + 25 .((…(((((((……)))))))..))…….(((((((…(((((..((((((.(.((……….((((((…)))))))).).))))))..))))))))))))………………………..
RS 1 seq GCCUGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGUGGUAUGCAGGUUCGCCUGUGAGCCCACGAGCGCCCCGCACCGCGGGGGUCUAGCAGAUCAGGUGAGAGGCCUGAGCCGACGGUCAUAGUCCGGAUGAAAGAGAACGCAG
RS 1 dot .((((….))))..((((…….))))((((..(((…(((((((((((((..((…..((..((((((…))))))..)).))..).)))))))…))))).)))..))))……………………..
RS 2 seq AUCGUUCAUCUUAUUUUAUUAAAUAAGACGGAAGUAGGAAGAUAGGAAAACCUCUUUCUUUUUUAAAGAAAGGCUAGCAAGUACCGCUUGGGUUAAUUUAUCUUAGGCGGGAACGAGACCGAAUAUCUGCCGAAGGAACGCGUU
RS 2 dot ….(((.((((((((….)))))))).)))……((((((((..(((((((((((((…))))))))……………..)))))..)))))))).((((((..((….))….))))))………….
RS 3 seq AUCGUUCAUCUUAUUUUAUUAAAUAGGACGGAAGUAGGAAGAUAGGAAAACCUCUUUCUUUUUUAAAGAAAGGCUAGCAAGUACCGCUUGGGUUAAUUUAUCUUAGGCGGGAACGAGACCGAAUAUCUGCCGAAGGAACGCGUU
RS 3 dot ….(((.((((((((….)))))))).)))……((((((((..(((((((((((((…))))))))……………..)))))..)))))))).((((((..((….))….))))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table