Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095619 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA095619
Gene: SEC14L2_0
MFE: -30.287
ENS: 0.897
Length: 98.
Predicted Ligands:
SAM - 12/20
glycine - 3/20
TPP - 3/20
RS: URS0000757946_171693
MFE: -24.448
Ligand: SAM
Species: Oceanobacillus picturae SAM riboswitch (S box leader)
RS: URS0000D8888B_1895746
MFE: -28.650
Ligand: SAM
Species: Clostridiales bacterium 38-18 SAM riboswitch (S box leader)
RS: URS0000D9F7AA_1907416
MFE: -28.367
Ligand: glycine
Species: Aeromonas sp. RU39B Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095619 URS0000757946_171693 URS0000D8888B_1895746 URS0000D9F7AA_1907416
Length 98. 98. 98. 99.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.897 - - -
MFE -30.287 -24.448 -28.650 -28.367
Ligands - SAM SAM glycine
Gene SEC14L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.007 6. 1.008
Length SE - 0. 0. 1.
Lev Distance - 25. 24. 25.
UBS 7. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 1. 1. 1. 1.
H 3. 3. 4. 3.
BL 3. 2. 3. 2.
BR 2. 2. 2. 2.
UN 0.133 0.214 0.112 0.222

Sequences

Field Description
UTR seq + 25 aaggagguuuuacugaaacauaucagcccugaccaggugccuguggaguaugggggcaccaugacugacccugATGAGCGGCAGAGTCGGCGATCTGA
UTR dot + 25 …..((((…((((……))))….)))).(((((((.((…..)).))))))).((.(((((.(((……..))).)))))))……
RS 1 seq UUCUUAUCCAGAGAGGUGGAGGGACUGGCCCAUUGAAACCUCAGCAACAGACAUUUGUACUGUGCUAAUUCCAGAAGCGUUAAGCUUGGAGAUAAGAA
RS 1 dot …………(((((.(((((…..))).))…)))))(((.((((((….)).)))))))..(((((..(((…..))))))))…….
RS 2 seq CUCUUAUCCAGAGUGGCGGAGGGACAGGCCCUAUGAUGCCCGGCAACCAGCGAAAGCAUGGUGCUAAUUCCUGCAGGUAAUAACCUGAGAGAUGAGAG
RS 2 dot ((((…..)))).((((.((((…..))))….)))).(((.((((((….)).)))))))…((((.(((((….))))))).))……
RS 3 seq GGACGAUACUCUGGAGAGACCCGUUAAAUCGGGCGCCGAAGGAGCAAGGUUCCCCCGAGGGAGCCGGAAACUCUCAGGCAAAAGGACAGAGGGGAUAGG
RS 3 dot ……..((((((…(.((((……))))).))…))))…(((((((….)))))))…..(((((.(………).)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table