Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095625 Similarity: 0.981 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA095625
Gene: SEC16A
MFE: -22.464
ENS: 0.708
Length: 94.
Predicted Ligands:
SAM - 12/20
TPP - 6/20
fluoride - 1/20
 RS: URS0000AB5217_675635
MFE: -34.020
Ligand: SAM
Species: Pseudonocardia dioxanivorans CB1190 SAM riboswitch (S box leader)
 RS: URS0000BFEA96_92647
MFE: -29.738
Ligand: fluoride
Species: Burkholderia tropica Fluoride riboswitch
 RS: URS0000AB33CA_334413
MFE: -19.117
Ligand: TPP
Species: Finegoldia magna ATCC 29328 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095625 URS0000AB5217_675635 URS0000BFEA96_92647 URS0000AB33CA_334413
Length 94. 92. 93. 95.
Similarity - 0.981 0.979 0.979
Ensemble Norm 0.708 - - -
MFE -22.464 -34.020 -29.738 -19.117
Ligands - SAM fluoride TPP
Gene SEC16A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.022 12.014 3.002
Length SE - 4. 1. 1.
Lev Distance - 20. 22. 26.
UBS 8. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 0. 1. 0. 1.
H 3. 3. 2. 3.
BL 4. 4. 4. 3.
BR 2. 2. 5. 3.
UN 0.181 0.033 0.301 0.137

Sequences

Field Description
UTR seq + 25 cuccaauuaaggaacagcuauauccugcuuccuucuguaagcagcaucgacuugugcaaggguucagucATGCAGCCACCGCCCCAGACGGTCC
UTR dot + 25 ……..(((((..(((……..))))))))……((.((((.(((.((.((….)).))))))))).)).((((…….))))..
RS 1 seq CGUCCAUCCAGAGCGGCCGAGAGACCGGGCUCGUCGACGUCGCAGCAACCACGCGCCACCGCGCGGGGUGCUAACGCCCGGAACGAUGGGAG
RS 1 dot ((((.((…((((..(((……))))))))).)))).((.((((.((.(((((….))))))).))))..))((((……))))..
RS 2 seq UCGUGCGCAGGAGAUGGCAUUCCUCCUGCAUUUUCCCCAACCGCCGGACCGGCAGCGCUGCUUCCUGCUCCGGCUGAUGAUGCCUGCGAGUCC
RS 2 dot ……(((((((………)))))))……..((.(.(((((((.((.(((…))).)).).)))))).).))…………..
RS 3 seq UUCGGAGUCUGGGGGUGCUUUACGCUGAGAUCUUUUUAGAAACCCUUAAACCUGCUCAUGAUAAUGCAUGCGAAGGGAAGAACUUAGAAUGUUUU
RS 3 dot …(((((((.((.(((…))).)).))).))))…….(((((…..(((.(((….)))…))))))))..((((…….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table