Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095755 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA095755
Gene: SEC23IP
MFE: -37.556
ENS: 1.
Length: 97.
Predicted Ligands:
tetrahydrofolate - 14/20
guanidine - 2/20
SAM - 1/20
 RS: URS0000C85A17_1263010
MFE: -22.029
Ligand: tetrahydrofolate
Species: Firmicutes bacterium CAG:227 THF riboswitch
 RS: URS000232ACA8_408172
MFE: -33.076
Ligand: guanidine
Species: marine metagenome Guanidine-I riboswitch
 RS: URS0000D7EBAB_319970
MFE: -22.050
Ligand: tetrahydrofolate
Species: Enterococcus devriesei THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095755 URS0000C85A17_1263010 URS000232ACA8_408172 URS0000D7EBAB_319970
Length 97. 97. 96. 97.
Similarity - 0.982 0.981 0.980
Ensemble Norm 1. - - -
MFE -37.556 -22.029 -33.076 -22.050
Ligands - tetrahydrofolate guanidine tetrahydrofolate
Gene SEC23IP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7.005 6.004
Length SE - 0. 1. 0.
Lev Distance - 23. 22. 24.
UBS 9. 9. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 4. 3. 3. 4.
H 1. 1. 1. 1.
BL 2. 3. 2. 1.
BR 3. 3. 1. 2.
UN 0.041 0.021 0.115 0.103

Sequences

Field Description
UTR seq + 25 gcgugaucgguuuccggucaguggugugguaccggguacccggagacguguaucggacggugggccgcagccATGGCCGAGAGAAAACCTAACGGTG
UTR dot + 25 .(((….((((((((((((.((((((((((((((((((.((….)).)))))…))))..)))))).))))))))).))…))))..)))…
RS 1 seq UGCAAAAUAGGAUUCUAUGCGUUAAGUGUUCAGUGGAUGGGGAGUUGCCGCAGAAACGAAAAGCUCGUCUUACGAUAUGGAGUCCGCACCCGUUGCA
RS 1 dot .((((….((((((((((((.(((((((((.((…((.((…..)).))…)))))…..)).)))))).))))))))))…….)))).
RS 2 seq GGAGAAACCUAGGGUUCCGGUUCCGUCAGGGAUGACUGGUCCGAGAGGUUUCGGUCGGUUCUGCCGACUGCACGGAGGGACAAAAGCCCGGGAGAC
RS 2 dot …….(((.(((((((..(((((((((((..((((((.(((((….)))))))))))…))..))).)))))))))…..)))))))….
RS 3 seq AUCAGAGUAGGAAAUAAAGCGUUAAGUGCUGGAAGGAUGGGAUGUUGCCUUCUGGACGAAAGACUUAGUCUGCGGUUUUAUUUUCGCAUUCGCUGCA
RS 3 dot ….((((.(((((((((((((((((((((((((((..(…..)..)))))))).)…..)))))….))).))))))))))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table