Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095764 Similarity: 0.980 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA095764
Gene: SEC23IP_0
MFE: -38.812
ENS: 1.
Length: 101.
Predicted Ligands:
purine - 11/20
TPP - 6/20
SAM - 1/20
 RS: URS0000C38A05_1268072
MFE: -28.070
Ligand: purine
Species: Paenibacillus sabinae T27 Purine riboswitch
 RS: URS0000C81894_1131935
MFE: -18.036
Ligand: purine
Species: Paenibacillus dendritiformis C454 Purine riboswitch
 RS: URS0000DB2B86_297318
MFE: -25.598
Ligand: purine
Species: Paenibacillus rhizosphaerae Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095764 URS0000C38A05_1268072 URS0000C81894_1131935 URS0000DB2B86_297318
Length 101. 102. 101. 102.
Similarity - 0.980 0.980 0.980
Ensemble Norm 1. - - -
MFE -38.812 -28.070 -18.036 -25.598
Ligands - purine purine purine
Gene SEC23IP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.009 6.014 3.011
Length SE - 1. 0. 1.
Lev Distance - 23. 25. 25.
UBS 8. 6. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 2. 2. 2. 2.
H 3. 2. 2. 2.
BL 2. 1. 2. 2.
BR 2. 2. 4. 2.
UN 0.089 0.186 0.208 0.196

Sequences

Field Description
UTR seq + 25 aggagcgugaucgguuuccggucaguggugugguaccggguacccggagacguguaucggacggugggccgcagccATGGCCGAGAGAAAACCTAACGGTG
UTR dot + 25 .(((((…….)))))((((((.((((((((((((((((((.((….)).)))))…))))..)))))).)))))))))…….(((….))).
RS 1 seq AAACUGAAGGCAUAAACAGCUCGUAUAAAUCCGGGGAUAGGGCCCGGAAGUUUCUACCCGGGAACCGUAAAUUUCCGGACUACGGGGAAUUAAAAGACAUCA
RS 1 dot …(((……….)))((((((….((((((((((.(((((((……….)))))..)).))..)))))))).))))))…………….
RS 2 seq AUAAUUUCAUCUUUCUGAACUCGUAUAAUUCCGGGAAUAUGGCCGGAAGUUUCUACCCAAGGACCGUAAAUCUUUGGACUACGAGAAUGACGACCAGACGG
RS 2 dot …..((((……))))((((((….(((((((.(((((((((.((…)).))…)).)))))..)))).))).))))))…………….
RS 3 seq AAUAAUCGAAUGAAUUGAUCUCGUAUAAUGCCGGGGAUAUGGCCCGGAAGUUUCUACCCGGAUACCGUAAAUGUCCGGACUACGAGGGAAUACUGCUGAGGA
RS 3 dot ….(((((…..)))))((((((….((((((.((((((.((((……….))))…)))))..).))))).)))))))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table