Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095782 Similarity: 0.952 Similarity: 0.941 Similarity: 0.938
UTR: 5HSAA095782
Gene: SEC24C_0
MFE: -44.335
ENS: 0.881
Length: 204.
Predicted Ligands:
cobalamin - 16/20
TPP - 2/20
SAM - 1/20
 RS: URS00019EBD68_1867952
MFE: -73.792
Ligand: cobalamin
Species: Candidatus Terasakiella magnetica Cobalamin
 RS: URS0002325E88_1891224
MFE: -33.776
Ligand: cobalamin
Species: Acinetobacter celticus Cobalamin riboswitch
 RS: URS0002332F89_1386078
MFE: -83.745
Ligand: cobalamin
Species: Pseudomonas sp. EGD-AK9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095782 URS00019EBD68_1867952 URS0002325E88_1891224 URS0002332F89_1386078
Length 204. 204. 205. 203.
Similarity - 0.952 0.941 0.938
Ensemble Norm 0.881 - - -
MFE -44.335 -73.792 -33.776 -83.745
Ligands - cobalamin cobalamin cobalamin
Gene SEC24C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18. 15.005 12.001
Length SE - 0. 1. 1.
Lev Distance - 54. 70. 75.
UBS 14. 16. 14. 14.
BS 0. 0. 0. 0.
ILL 7. 7. 6. 7.
ILR 5. 7. 4. 7.
H 1. 1. 1. 1.
BL 2. 5. 5. 4.
BR 4. 5. 6. 2.
UN 0.039 0.025 0.112 0.064

Sequences

Field Description
UTR seq + 25 aaccggaaguggagccugggagccuugacguuaggaacgaagucuaaccuggaucuggagccgggagauaaucugaaugcuggcuggggcagaaaauuacuaagauccuguggaagugugaggauuauuaaacugaucacugucugauaaggugagaucaaauugggaaugcuuucauaATGAACGTCAACCAGTCAGTTCCAC
UTR dot + 25 ……..(((((((((((…..((((((((……(((((((.((((..(((.(((..(((((((((((((..(((((..((…((((……………)))))).)))))..))))))))…….)).))))))))).)))).))))……………)))……))))))))))))…)))))))
RS 1 seq CGAUCCGCCCGUUCCUCCAGUAAACCGUCUGCGUUCAGUAUCCCGGAACACGGUGCAAAUCCGUGGCGGUCCCGCCGCUGUAAUCGGGGACGCGGGGGCGCGAAGGGCGUCAAAGCCCGGCCACUGGCGGAAUUUCCGCCGGGAAGGUGCGCUUUCGCGGCAGAUCCGAGAGCCAGAAGACCUGCUGGACAUGGUUCAUCACGG
RS 1 dot .(((….((((…(((((((…..((((.((((.(.(((((((((…((((((..(((.((((((..((((((.((…((((((((((………….)))))….))))).)).))))))…..)))))))))…))))))))).)))..))).)..))))))))…..))))))).))))…)))….
RS 2 seq UGCGCGCAAAAUGCAACAAGUCCAAGCACUCGCUUUAGGGAAGUCGGUUAAAAUCCAACACUGCCCCCGCAACGGUAAAAUGAAAAGCUUAUCUUUCAUAAAUCAUAGAGAUUUACAUCACUGCAUAGCCAUGUGGGAAGGUGGAUAAGUAGCUUUAUUAUAAGCACAUUUAAGUCCGGAAACCUGCUUGUUGCCCCUCAACUCA
RS 2 dot …………(((((((((((..((….(((((((.(((((.(.(((…(((.((.((…((((((..(((…………..((((((……….))))))……………))).)))))).)))))))))).).))))).))).))))……..))..))……)))))))))………..
RS 3 seq CAUUGCAUGUUCCGCCAGGGUGCGCCGCUAACACGGCGUGAAACGGGAAGUCGGUGCGCCCAUCCGGGCAACCCCGACGCUGCCCCCGCAACGGUAAUCGACGGCAGGCCGCAAGCCUGCACCUUGUCCACGGCCACUGGGUAUUCCCGGGAAGGCGGACCGGGGUCGUGAGCCCGGAGACCGGCCCCGGCGGUGCGACUGGU
RS 3 dot ………….(((((..((((((((……………((((..((((((.(…..(((((((.((((((.((((..((((.((..(((….((((((((((…..))))))….))))….)))..)).)…….)))..))))…))))))…..)))))))))))))))))))))))))).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table