Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095783 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA095783
Gene: SEC24C_1
MFE: -32.285
ENS: 0.997
Length: 118.
Predicted Ligands:
SAM - 10/20
cobalamin - 4/20
FMN - 3/20
 RS: URS000232DD31_929563
MFE: -32.516
Ligand: cobalamin
Species: Leptonema illini DSM 21528 Cobalamin riboswitch
 RS: URS000231E3A9_1884656
MFE: -19.266
Ligand: cobalamin
Species: Epulopiscium sp. Nuni2H_MBin001 Cobalamin riboswitch
 RS: URS0000AB83F9_545693
MFE: -32.
Ligand: SAM
Species: Bacillus megaterium QM B1551 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095783 URS000232DD31_929563 URS000231E3A9_1884656 URS0000AB83F9_545693
Length 118. 118. 118. 118.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.997 - - -
MFE -32.285 -32.516 -19.266 -32.
Ligands - cobalamin cobalamin SAM
Gene SEC24C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.002 11.009 7.006
Length SE - 0. 0. 0.
Lev Distance - 32. 32. 34.
UBS 6. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 3. 3. 5. 3.
H 1. 1. 1. 1.
BL 1. 3. 2. 2.
BR 1. 1. 2. 2.
UN 0.076 0.119 0.169 0.

Sequences

Field Description
UTR seq + 25 gaaccggaaguggagccugggagccuugacguuaggaacgaagucuaaccuggaucuggagccgggugagaucaaauugggaaugcuuucauaATGAACGTCAACCAGTCAGTTCCAC
UTR dot + 25 ………(((((((((((…..((((((((……(((((((.((((((……..)))))).))))……………)))……))))))))))))…)))))))
RS 1 seq CGUCAAUGCAGCGGAAAAGAUUCUGUCCCUACUUUCGGGAGGAACCGGGUGCAAGUCCCGGGCUGUCGCGCAACUGUAAGUUCGAAAGAACAAGCCAGAUCUUCCCUGCAAUUCGGUC
RS 1 dot ……(((((.(((..((((.(((……(((((((((.(..(((((…….)))))..).))…………..)))))))…….)))))))))))))))……..
RS 2 seq UAAAAAAUAAAAGUAUUAGGUUUUGUCACAAGACAAAUUAAAAGGGGAAGUAGGGUGAAAGUCCCACACGGUCCCGCCACUGUAAAGUCAGAUUACCUGCCUAAAUACUGCCUUAUGU
RS 2 dot ………..((((((((((…((…..(((………(((((.((.(((…….)))..))..)))).)………)))…..))..)))))).))))………
RS 3 seq CUCUUAUCCCGAGCUGGUGGAGGGACAGGCCCUAUGAAACCCAGCAACCAUCGUCAUUUUUUUGUGUAGACGAUAAGGUGCUAACCUGAUGCAAGGGCACAACCUUGAUCGAUAAGAG
RS 3 dot ((((((((…….(((.((((…..(((((………(((.(((((((((((……..)).))))))..))))))………..)))))….)))).)))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table