Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA095814 Similarity: 0.969 Similarity: 0.968 Similarity: 0.968
UTR: 5HSAA095814
Gene: SEC24D
MFE: -29.797
ENS: 0.981
Length: 130.
Predicted Ligands:
FMN - 12/20
cobalamin - 5/20
molybdenum - 2/20
 RS: URS000231F6F5_1435356
MFE: -66.688
Ligand: cobalamin
Species: Rhodococcus pyridinivorans SB3094 Cobalamin riboswitch
 RS: URS000232494F_1114943
MFE: -51.721
Ligand: cobalamin
Species: Streptomyces tsukubensis NRRL18488 Cobalamin riboswitch
 RS: URS0000C1EB08_1743146
MFE: -35.195
Ligand: FMN
Species: Bacillus sp. FJAT-27986 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA095814 URS000231F6F5_1435356 URS000232494F_1114943 URS0000C1EB08_1743146
Length 130. 129. 129. 131.
Similarity - 0.969 0.968 0.968
Ensemble Norm 0.981 - - -
MFE -29.797 -66.688 -51.721 -35.195
Ligands - cobalamin cobalamin FMN
Gene SEC24D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 3.002 9.001
Length SE - 1. 1. 1.
Lev Distance - 36. 40. 37.
UBS 12. 10. 12. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 0. 3. 4.
H 2. 2. 2. 2.
BL 5. 5. 4. 7.
BR 6. 5. 5. 6.
UN 0.031 0.016 0.070 0.069

Sequences

Field Description
UTR seq + 25 guagugcauugcacggguacgucaucaaaugugcguguacacgugccagauucgccuuuaaacgacuucuuuuguagaauuauccuauggaaugauauuuucauaATGAGTCAACAAGGTTACGTGGCTA
UTR dot + 25 ((.(((((.((((((…………..)))))))))))))..((((..(..(((((…..(((((.((.((.((((((((((…))).)))).))).)).)).)))))…))))).)..))))..
RS 1 seq CGCUGCGGGUGUCCUGCCGAUCCGGUAGGGCACCCGCUGCGUUUUCGGUGAAGCCGGUGAGAUUCCGGCGCUGUCCCGCAACUGUAAGUCCCGAUACGGGGUGAGCCAGGUCGGCCGGCGCGGAGGGUC
RS 1 dot (((.(((((((((((((((…))))))))))))))).)))(((((.((…(((((…….(((((.(((.(.(((..(((((……..))))).))).).))))))))))))))).)))))..
RS 2 seq GGCCACAUGUUCCAAUCCGGCUGAUACAUGCUCAUGACCAGGGGAAGCCGGUGGAAAUCCGGCGCUGACCCGCAACCGUGAGUCCGCCGGGCGGCGGACGAGCCGGACUGCCUGGGAUGGGUGCUCGAU
RS 2 dot ………(((((..((((((……(.(((…….))).))))))))))))(((.((((((.(((((((.((((..(((((((….)))))))..)).))..)))..))).).)))))).)))
RS 3 seq GUCUAUCUUCGGGGCAGGGUGAAAUUCCCUACCGGCGGUGAUGAUUUAUAAUCUAAGCCCGCGAGCCUGUAAAGGCAGGAUUUGGUGAGAUUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGAAGAUGGAG
RS 3 dot (((.(((.(((.((.((((…….)))).))..))).))))))…..((((…(((((.((.(((((…(..((.(((((…….))))).))..)..))))).)).).))))…))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table