Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096003 Similarity: 0.984 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA096003
Gene: SEL1L
MFE: -28.797
ENS: 0.911
Length: 70.
Predicted Ligands:
2'-dG-II - 8/20
cobalamin - 3/20
glycine - 3/20
 RS: URS0000C543C7_477245
MFE: -30.458
Ligand: cobalamin
Species: Streptomyces cyaneogriseus subsp. noncyanogenus Cobalamin riboswitch
 RS: URS0000BE3452_869279
MFE: -22.803
Ligand: fluoride
Species: Thermanaerothrix daxensis Fluoride riboswitch
 RS: URS0002312703_1652545
MFE: -27.921
Ligand: zmp-ztp
Species: Arthrobacter sp. YC-RL1 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096003 URS0000C543C7_477245 URS0000BE3452_869279 URS0002312703_1652545
Length 70. 70. 69. 72.
Similarity - 0.984 0.982 0.981
Ensemble Norm 0.911 - - -
MFE -28.797 -30.458 -22.803 -27.921
Ligands - cobalamin fluoride zmp-ztp
Gene SEL1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 9.036 9.002
Length SE - 0. 1. 4.
Lev Distance - 21. 20. 18.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 2. 1. 0. 1.
H 3. 2. 2. 2.
BL 1. 1. 1. 3.
BR 1. 2. 3. 2.
UN 0.071 0.114 0.261 0.111

Sequences

Field Description
UTR seq + 25 gcgaaggcgacagcucuagggguuggcaccggccccgagaggaggATGCGGGTCCGGATAGGGCTGACGC
UTR dot + 25 ((….))..(..((((.(((((((….))))))).))))..)…((((((((…..)))))..)))
RS 1 seq GGGGAAGCCGGUGCAAUUCCGGCGCUGACCCGCAGCCGUGAGCCGCCCGGGGCGGUGAGCCGGAUCGCCC
RS 1 dot ……..(((.((..(((((((((……)).)))).)))..)))))(((((((…….)))))))
RS 2 seq GCAGCUUGCGGUGAUGAGGCUCACCGGAGACCCAAACCGCCCAUCAGGGCUGAUAGCCUCUGUCGUUUC
RS 2 dot …….(((((..((.(((((….))).)))).)))))….(((((((…)))).)))…….
RS 3 seq AACCCGUGACUGGCGUUUGGUGGACUACCACCGGGGAGCUAAUCGUGGGAGCCGCGCGCCUGGGUUCGCACA
RS 3 dot …….((.((((.((((((((….))))))))..)))).))(((.(((((………))))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table