Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096224 Similarity: 0.986 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA096224
Gene: SENP2
MFE: -28.555
ENS: 0.855
Length: 78.
Predicted Ligands:
homocysteine - 7/20
SAM - 6/20
cobalamin - 3/20
 RS: URS000232483E_1449976
MFE: -42.456
Ligand: zmp-ztp
Species: Kutzneria albida DSM 43870 ZMP/ZTP riboswitch
 RS: URS0000BF6C84_1765722
MFE: -28.
Ligand: cobalamin
Species: Streptomyces silvensis Cobalamin riboswitch
 RS: URS0000C10E4A_1348657
MFE: -24.101
Ligand: homocysteine
Species: Thauera terpenica 58Eu S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096224 URS000232483E_1449976 URS0000BF6C84_1765722 URS0000C10E4A_1348657
Length 78. 79. 78. 77.
Similarity - 0.986 0.986 0.985
Ensemble Norm 0.855 - - -
MFE -28.555 -42.456 -28. -24.101
Ligands - zmp-ztp cobalamin homocysteine
Gene SENP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.003 4.006 10.001
Length SE - 1. 0. 1.
Lev Distance - 15. 18. 16.
UBS 5. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 0. 2. 0.
H 2. 2. 1. 2.
BL 1. 2. 1. 3.
BR 2. 4. 3. 1.
UN 0.141 0.089 0.218 0.169

Sequences

Field Description
UTR seq + 25 gcgaccgaacucuggcgguggugguuaagacgccgcugcugcuugggccugguATGTACAGATGGCTGGTTAGGATTC
UTR dot + 25 (((((((..(((.((((((((((((……)))))))))))).)))..)))).))).(((….)))……….
RS 1 seq GGCCGGUGCCGGAAUGGUCGGUGCGGUGGGUGGACCACCGACGACCGGCUGGAACGGGCCGUCCGACUGGGCCCGCCCA
RS 1 dot ((((.((.((((..((((((…((((((…..)))))).)))))).)))).)).))))((((….))))…….
RS 2 seq CAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUGACCGGCCCGCGUCCGCGCGGUCCGCGAGCCAGGAACUG
RS 2 dot ..(((.(((((((((…((((((((((……)))))).))))..)))).))).))..)))……………
RS 3 seq CUUGCCGAGGAGCGUUGCGACCCCGAUCAGAAAUUCGCGGGCCAGGCUCGGCAACCGAUCAACGGCGCUCACAAACC
RS 3 dot .(((((…((((.(((.(.((((((……..))).))))))))))))))))(((…..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table