Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096226 Similarity: 0.983 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA096226
Gene: SENP2_0
MFE: -16.335
ENS: 0.811
Length: 84.
Predicted Ligands:
cyclic-di-GMP - 8/20
glycine - 4/20
zmp-ztp - 3/20
 RS: URS0000BF8AA2_273057
MFE: -29.144
Ligand: fluoride
Species: Sulfolobus solfataricus P2 Fluoride riboswitch
 RS: URS0000AB7E8A_555088
MFE: -23.
Ligand: cyclic-di-GMP
Species: Dethiobacter alkaliphilus AHT 1 Cyclic di-GMP-II riboswitch
 RS: URS0000C2FFD5_1424294
MFE: -21.884
Ligand: cyclic-di-GMP
Species: Geosporobacter ferrireducens Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096226 URS0000BF8AA2_273057 URS0000AB7E8A_555088 URS0000C2FFD5_1424294
Length 84. 85. 83. 84.
Similarity - 0.983 0.981 0.981
Ensemble Norm 0.811 - - -
MFE -16.335 -29.144 -23. -21.884
Ligands - fluoride cyclic-di-GMP cyclic-di-GMP
Gene SENP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6.001 10.001
Length SE - 1. 1. 0.
Lev Distance - 20. 23. 23.
UBS 4. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 3. 1. 1. 1.
ILR 1. 2. 2. 2.
H 1. 1. 1. 1.
BL 0. 1. 1. 2.
BR 1. 2. 1. 1.
UN 0.048 0.047 0.072 0.024

Sequences

Field Description
UTR seq + 25 auaaggaucuucuuggagaacuggggcaucugauuggaacaccugcgaaagcuuaagcgATGTACAGATGGCTGGTTAGGATTC
UTR dot + 25 ….(((((((…….((((((..((((((…………((….))…………)))))).)))))))))))))
RS 1 seq AAUGAAGUAGGGGAUGGCGUCCCCCUGGGGAUAACCCCGAACCGCCUCUUGAUUAAUGAUAGGGGCUGAUGACGCCUACUUCACC
RS 1 dot ..(((((((((.(….(((((((((((((….))))………………….)))))..)))).).)))))))))..
RS 2 seq CAAGUGUGCGGAAUCAAUGACCGCGACUCUCAUUUGGUCACUUUAGGGUCGCGCGAGAUAGAGUGAAACCGGCUGCACACGGG
RS 2 dot …((((((((……(.(((((((((((…………..)))))))))………)).)……))))))))…
RS 3 seq UUGAAGAAAGGGAGCGUUGAAGCGUGUUUUUCAUCUGGGCACUUGAAAUACGUGGAGCGAGUAGUGCAACCGACCUUUCUUUAA
RS 3 dot .((((((((((..(.((((.((((((((((…………..)))))))))………..).)))))..)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table