Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096469 Similarity: 0.971 Similarity: 0.971 Similarity: 0.968
UTR: 5HSAA096469
Gene: SERF2
MFE: -40.358
ENS: 1.
Length: 123.
Predicted Ligands:
SAM - 7/20
cobalamin - 4/20
guanidine - 4/20
RS: URS0000AB3BFF_861360
MFE: -40.599
Ligand: methionine
Species: Glutamicibacter arilaitensis Re117 S-adenosyl methionine (SAM) riboswitch,
RS: URS0000C54C73_67285
MFE: -46.310
Ligand: cobalamin
Species: Streptomyces cellostaticus Cobalamin riboswitch
RS: URS0000C20EFE_866499
MFE: -35.525
Ligand: molybdenum
Species: Cloacibacillus evryensis DSM 19522 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096469 URS0000AB3BFF_861360 URS0000C54C73_67285 URS0000C20EFE_866499
Length 123. 122. 123. 124.
Similarity - 0.971 0.971 0.968
Ensemble Norm 1. - - -
MFE -40.358 -40.599 -46.310 -35.525
Ligands - methionine cobalamin molybdenum
Gene SERF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 3.005 3.
Length SE - 1. 0. 1.
Lev Distance - 37. 38. 41.
UBS 9. 9. 10. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 4. 3. 4. 5.
H 3. 3. 3. 3.
BL 3. 3. 4. 2.
BR 1. 2. 2. 1.
UN 0.089 0.066 0.163 0.105

Sequences

Field Description
UTR seq + 25 aggaacgacugugcuacguugccagaaggggcgggaccugcaacguccgacagaacgaggggacguaacggaggcagguuggagccgcugccgucgccATGAAAAAGCAGAGCGACTCGGTTA
UTR dot + 25 ……..(((.((……))))).((.(((..(((((((.((((((…………))))))…….)))))))…))).))((((((((..((……))..)))))..)))..
RS 1 seq AAUCACGAGUUCCACUGCUUGAGCCCUGGCUGAGUGGACGGCAACCCUCCUUCGUCAUUGUGCGGGGUGCCCCAGGUGAAGAUUCGACGCAUCUUGACCGCCAAGGUGCGUAAGCGAUGGCG
RS 1 dot …..((((((…..(((((.(((((.((..(((.(((((……….))))))))..)).))).))..)))))…))))))((((((((((…..))))))))))..((….)).
RS 2 seq GAGGAAACCGGUGUGAAUCCGGUGCGGUCCCGCCACUGUGAUCGGUGAGCGAGUUCCGACAGGCCACUGUCCGUGAGGGGCGGGAAGGCCGGGACGCGUGACGACCCGAGAGCCAGGAGACUC
RS 2 dot ……(((((…….)))))….(((((((.((.((..(((((.((..((….))..)))))))..))..)).))))))).(((((((.((…..)).))))…)))………
RS 3 seq AACUGAAUAAUACCCCGAGUCAAAGCUCCUACAGAGAAAAAUAAUUCUCAAUGGAGCACGACCAUUGGGUGUCUUUGGAAACGAAGGUGCCUCCCGUCUGGAAAGGGGAAAGGAGAUCGCGGGC
RS 3 dot ………((((((…(((…(((((….(((((……)))))…)))))..)))….))))))(((((….)))))(((.(((((.(((….))).)…))))..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table