Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096547 Similarity: 0.929 Similarity: 0.929 Similarity: 0.928
UTR: 5HSAA096547
Gene: SERINC4
MFE: -62.701
ENS: 0.844
Length: 214.
Predicted Ligands:
cobalamin - 19/20
glucosamine - 1/20

 RS: URS000231B7D2_1895743
MFE: -51.688
Ligand: cobalamin
Species: Chlamydiales bacterium 38-26 Cobalamin riboswitch
 RS: URS000232AC59_1218169
MFE: -85.538
Ligand: cobalamin
Species: Pseudomonas putida S11 Cobalamin riboswitch
 RS: URS0000DF5203_44250
MFE: -60.992
Ligand: cobalamin
Species: Paenibacillus alvei Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096547 URS000231B7D2_1895743 URS000232AC59_1218169 URS0000DF5203_44250
Length 214. 212. 214. 213.
Similarity - 0.929 0.929 0.928
Ensemble Norm 0.844 - - -
MFE -62.701 -51.688 -85.538 -60.992
Ligands - cobalamin cobalamin cobalamin
Gene SERINC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.002 26. 28.
Length SE - 4. 0. 1.
Lev Distance - 78. 81. 80.
UBS 12. 13. 15. 15.
BS 1. 0. 0. 0.
ILL 4. 2. 5. 6.
ILR 3. 3. 5. 5.
H 4. 6. 5. 4.
BL 4. 4. 5. 3.
BR 5. 2. 2. 2.
UN 0.107 0.156 0.089 0.094

Sequences

Field Description
UTR seq + 25 cugccuccugcugucaaggacaguaguggaaaggguguggggcaagacacacaggguaagugagagggggucggguugucaggugggaagagauaaaaggaaaaacccuaagauagaaaagguuucgguugggggcaggagacaaaugaguggucauacccgugacaaguagguaccuuuccaugcauuATGGTGGGTGCCAAGGCCGGCCCCA
UTR dot + 25 ((.((..((((((((…)))))))).))..)).(((((……..)))))…………..((((((((.((((((((((.((……………..((((..(((.((((…)))).))).))))………………)).))))..))))))…(((((((..(((((…))))).)))))))….)))))))).
RS 1 seq GAGAGGCUCUCUUAGAUAAGUGUCUCUUGCUACGGCUUGAGAAGAAUAGGGAAACAGGUGAGAAUCCUGUGCGGUGACGCCGCUGUAACGGAUGACGAAAGCCUAAAUUCUCUAUAGAAAUAUAGAGAAUUCAACCACUGCUUUUAAAGCGGGAAGGAGGGUAAUUAGGAUGAAUCCGAAGUCAGAAGACCUGCUUAUCUAUGCUCAUCACA
RS 1 dot (((((((.((……..)).)))))))……(((((……………)))))….((((..(((((((….)))))))..))))…………(((((((((((….)))))))))))..(((.((.(((((……))))).)))))……(((((….((((.(((…..)))))..))…..)))))…
RS 2 seq GUAGCCUUGCCACUUCGAGGUUCUUCGGCCAGGCCGAAGCUAAGACGGGAACGCGGUACAAGCCGCGGCUGCCCCCGCAACUGUAAGCACCGACAACGGAUCGACACAGCCACUGCGCCCGCGCGCGGGAAGGCGUCAUCCCGCCAGACCGCUGCACCAGCGGGGCACAUGGAACGGUGCGAGCCAGGAGACCUGCCUCGUCACGUUUUCGACU
RS 2 dot ..(((((((……)))))))(((((((…)))))))…….(.(..((((((….))))))..).)((((((…(((.(((………((((.(((…(((.((((((….))))))…))))))))))………))))))…))))))…..((((((..(((((.((((…)))).)))))..))))))…..
RS 3 seq GACACCGAUGUAUUAUAUGGCCGAUGCAUAUUCGAGGUUAAUAGGGAAGCCGGUGUGAACCCGGCGCGGUCCCGCCACUGUGAAUGGAGUGUUGCGCUCAUGAUGCCACUGUCGAAUUCGUUAGUGUGUGCUGUAUGUACCGCUAUGGAUGGGAAGGCGAGCUGCAACGUAUUCUCCUAAGUCAGGAAACCUGCCUGAAGAUGGACGAGCUGU
RS 3 dot (((..(((((((((……..))))))…)))..)))….((((.(((((…….)))))….))))……..(((((…((((((((((…..(((….((..(((((.(((((.((((…..))))))))))))))..)).))))))).)))))))))))(((….(((((…….)))))….)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table