Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096663 Similarity: 0.976 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA096663
Gene: SERPINB6
MFE: -35.778
ENS: 0.924
Length: 105.
Predicted Ligands:
TPP - 9/20
glycine - 6/20
homocysteine - 2/20
 RS: URS0000C66304_1660133
MFE: -40.407
Ligand: homocysteine
Species: Rhodanobacter sp. SCN 67-45 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB85D9_667137
MFE: -28.217
Ligand: TPP
Species: Thermoplasmatales archaeon E-plasma TPP riboswitch (THI element)
 RS: URS000232ECA0_1609099
MFE: -49.563
Ligand: TPP
Species: Streptomyces sp. NRRL F-6602 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096663 URS0000C66304_1660133 URS0000AB85D9_667137 URS000232ECA0_1609099
Length 105. 104. 104. 106.
Similarity - 0.976 0.975 0.974
Ensemble Norm 0.924 - - -
MFE -35.778 -40.407 -28.217 -49.563
Ligands - homocysteine TPP TPP
Gene SERPINB6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 8. 2.001
Length SE - 1. 1. 1.
Lev Distance - 29. 29. 33.
UBS 10. 11. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 4. 3. 5. 4.
H 2. 2. 2. 2.
BL 5. 5. 4. 4.
BR 2. 3. 1. 2.
UN 0.086 0.077 0.096 0.057

Sequences

Field Description
UTR seq + 25 cuucgcgcuccggacgggcgacgguagcucgagacccgggacuccgcccgccuccccgcgaguauuugaggucugccaucATGTCTTCAAGGCAAAGAGGAAACT
UTR dot + 25 (((((.(((((((..(((((.(((.((((((…..)))).)))))..)))))..))).))))…)))))….((.((.(((((…)))))..))))…..
RS 1 seq CCCGCCGAGGGGCGCUGCGACCGUUGGCGUGAGGCAGAUCCAUCUGCAGCCCCACGCAUCGGCCAGGCUCGGCGCGGCACGUUCCACAACGGCGCCCGGUUGUC
RS 1 dot ..(((((((((.((.((((…..(((.(.(..(((((….)))))..))))))))).)).))…)))))))((((.((((….))))..))).)……
RS 2 seq UGGAUCAGCUAGGGGAGCGAAAAUUGCUGAGAGGGCAGGAAUCACUGCCGACCCUUGAACCUGAUCCGGGUAAUACUGGCGAAGGAAAGCAUCUAGCGAACAUC
RS 2 dot ((((((((.((((((.(((…(((.(((……))).)))…)))…))))))…))))))))……..((.((..(((…..)))..))..))..
RS 3 seq ACGCGGGAGCCCGGGCGCACCGGGCUGAGAGGGAGGCUGAGACGGCCUCCGACCGUCCGAACCUGAUCCGGGUCAUUCCGGCGAAGGGAGCAGCGGCAAACCCAUG
RS 3 dot .(((.((((((((((((…(((((.(.(..((((((((…))))))))..)))))))….)).)))))))…))).)))..(((.((….))…)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table